ID: 1075088508 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:119429943-119429965 |
| Sequence | GACCTCCTTCGCGTCCTTTG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1075088502_1075088508 | 19 | Left | 1075088502 | 10:119429901-119429923 | CCTGCTGGGCAGACTGAGATGCA | No data | ||
| Right | 1075088508 | 10:119429943-119429965 | GACCTCCTTCGCGTCCTTTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1075088508 | Original CRISPR | GACCTCCTTCGCGTCCTTTG TGG | Intronic | ||