ID: 1075088509

View in Genome Browser
Species Human (GRCh38)
Location 10:119429944-119429966
Sequence ACCTCCTTCGCGTCCTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075088502_1075088509 20 Left 1075088502 10:119429901-119429923 CCTGCTGGGCAGACTGAGATGCA No data
Right 1075088509 10:119429944-119429966 ACCTCCTTCGCGTCCTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075088509 Original CRISPR ACCTCCTTCGCGTCCTTTGT GGG Intronic