ID: 1075088512

View in Genome Browser
Species Human (GRCh38)
Location 10:119429951-119429973
Sequence TCGCGTCCTTTGTGGGACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075088502_1075088512 27 Left 1075088502 10:119429901-119429923 CCTGCTGGGCAGACTGAGATGCA No data
Right 1075088512 10:119429951-119429973 TCGCGTCCTTTGTGGGACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075088512 Original CRISPR TCGCGTCCTTTGTGGGACGC TGG Intronic