ID: 1075098580

View in Genome Browser
Species Human (GRCh38)
Location 10:119490003-119490025
Sequence ATGCTTTTCTGGGAGGTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075098580_1075098588 6 Left 1075098580 10:119490003-119490025 CCCGGGACCTCCCAGAAAAGCAT No data
Right 1075098588 10:119490032-119490054 AGCTCTGCCCTAGGAGACCATGG No data
1075098580_1075098587 -3 Left 1075098580 10:119490003-119490025 CCCGGGACCTCCCAGAAAAGCAT No data
Right 1075098587 10:119490023-119490045 CATGTGGGCAGCTCTGCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075098580 Original CRISPR ATGCTTTTCTGGGAGGTCCC GGG (reversed) Intergenic
No off target data available for this crispr