ID: 1075099554

View in Genome Browser
Species Human (GRCh38)
Location 10:119496488-119496510
Sequence CAGGGTAAACAGGCTTCGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075099554_1075099560 8 Left 1075099554 10:119496488-119496510 CCGTCCGAAGCCTGTTTACCCTG No data
Right 1075099560 10:119496519-119496541 TTCCAAAGAAACCACAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075099554 Original CRISPR CAGGGTAAACAGGCTTCGGA CGG (reversed) Intergenic
No off target data available for this crispr