ID: 1075106483

View in Genome Browser
Species Human (GRCh38)
Location 10:119542968-119542990
Sequence CCGGCGGCGCGGGCTCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075106483_1075106496 16 Left 1075106483 10:119542968-119542990 CCAGAGGGAGCCCGCGCCGCCGG No data
Right 1075106496 10:119543007-119543029 CGGAGGCGGTTAGCGCGTCCCGG No data
1075106483_1075106499 25 Left 1075106483 10:119542968-119542990 CCAGAGGGAGCCCGCGCCGCCGG No data
Right 1075106499 10:119543016-119543038 TTAGCGCGTCCCGGGGTCCCTGG No data
1075106483_1075106497 17 Left 1075106483 10:119542968-119542990 CCAGAGGGAGCCCGCGCCGCCGG No data
Right 1075106497 10:119543008-119543030 GGAGGCGGTTAGCGCGTCCCGGG No data
1075106483_1075106498 18 Left 1075106483 10:119542968-119542990 CCAGAGGGAGCCCGCGCCGCCGG No data
Right 1075106498 10:119543009-119543031 GAGGCGGTTAGCGCGTCCCGGGG No data
1075106483_1075106490 -4 Left 1075106483 10:119542968-119542990 CCAGAGGGAGCCCGCGCCGCCGG No data
Right 1075106490 10:119542987-119543009 CCGGGAACTTAGTAGCCCCGCGG No data
1075106483_1075106491 -1 Left 1075106483 10:119542968-119542990 CCAGAGGGAGCCCGCGCCGCCGG No data
Right 1075106491 10:119542990-119543012 GGAACTTAGTAGCCCCGCGGAGG No data
1075106483_1075106492 2 Left 1075106483 10:119542968-119542990 CCAGAGGGAGCCCGCGCCGCCGG No data
Right 1075106492 10:119542993-119543015 ACTTAGTAGCCCCGCGGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075106483 Original CRISPR CCGGCGGCGCGGGCTCCCTC TGG (reversed) Intergenic
No off target data available for this crispr