ID: 1075106486

View in Genome Browser
Species Human (GRCh38)
Location 10:119542978-119543000
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075106486_1075106498 8 Left 1075106486 10:119542978-119543000 CCCGCGCCGCCGGGAACTTAGTA No data
Right 1075106498 10:119543009-119543031 GAGGCGGTTAGCGCGTCCCGGGG No data
1075106486_1075106492 -8 Left 1075106486 10:119542978-119543000 CCCGCGCCGCCGGGAACTTAGTA No data
Right 1075106492 10:119542993-119543015 ACTTAGTAGCCCCGCGGAGGCGG No data
1075106486_1075106496 6 Left 1075106486 10:119542978-119543000 CCCGCGCCGCCGGGAACTTAGTA No data
Right 1075106496 10:119543007-119543029 CGGAGGCGGTTAGCGCGTCCCGG No data
1075106486_1075106499 15 Left 1075106486 10:119542978-119543000 CCCGCGCCGCCGGGAACTTAGTA No data
Right 1075106499 10:119543016-119543038 TTAGCGCGTCCCGGGGTCCCTGG No data
1075106486_1075106497 7 Left 1075106486 10:119542978-119543000 CCCGCGCCGCCGGGAACTTAGTA No data
Right 1075106497 10:119543008-119543030 GGAGGCGGTTAGCGCGTCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075106486 Original CRISPR TACTAAGTTCCCGGCGGCGC GGG (reversed) Intergenic