ID: 1075106488

View in Genome Browser
Species Human (GRCh38)
Location 10:119542984-119543006
Sequence CGGGGCTACTAAGTTCCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075106488_1075106499 9 Left 1075106488 10:119542984-119543006 CCGCCGGGAACTTAGTAGCCCCG No data
Right 1075106499 10:119543016-119543038 TTAGCGCGTCCCGGGGTCCCTGG No data
1075106488_1075106497 1 Left 1075106488 10:119542984-119543006 CCGCCGGGAACTTAGTAGCCCCG No data
Right 1075106497 10:119543008-119543030 GGAGGCGGTTAGCGCGTCCCGGG No data
1075106488_1075106498 2 Left 1075106488 10:119542984-119543006 CCGCCGGGAACTTAGTAGCCCCG No data
Right 1075106498 10:119543009-119543031 GAGGCGGTTAGCGCGTCCCGGGG No data
1075106488_1075106496 0 Left 1075106488 10:119542984-119543006 CCGCCGGGAACTTAGTAGCCCCG No data
Right 1075106496 10:119543007-119543029 CGGAGGCGGTTAGCGCGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075106488 Original CRISPR CGGGGCTACTAAGTTCCCGG CGG (reversed) Intergenic
No off target data available for this crispr