ID: 1075106492

View in Genome Browser
Species Human (GRCh38)
Location 10:119542993-119543015
Sequence ACTTAGTAGCCCCGCGGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075106482_1075106492 3 Left 1075106482 10:119542967-119542989 CCCAGAGGGAGCCCGCGCCGCCG No data
Right 1075106492 10:119542993-119543015 ACTTAGTAGCCCCGCGGAGGCGG No data
1075106486_1075106492 -8 Left 1075106486 10:119542978-119543000 CCCGCGCCGCCGGGAACTTAGTA No data
Right 1075106492 10:119542993-119543015 ACTTAGTAGCCCCGCGGAGGCGG No data
1075106487_1075106492 -9 Left 1075106487 10:119542979-119543001 CCGCGCCGCCGGGAACTTAGTAG No data
Right 1075106492 10:119542993-119543015 ACTTAGTAGCCCCGCGGAGGCGG No data
1075106483_1075106492 2 Left 1075106483 10:119542968-119542990 CCAGAGGGAGCCCGCGCCGCCGG No data
Right 1075106492 10:119542993-119543015 ACTTAGTAGCCCCGCGGAGGCGG No data
1075106475_1075106492 30 Left 1075106475 10:119542940-119542962 CCCCGCGCCTGGGATAAGGTGCA No data
Right 1075106492 10:119542993-119543015 ACTTAGTAGCCCCGCGGAGGCGG No data
1075106479_1075106492 23 Left 1075106479 10:119542947-119542969 CCTGGGATAAGGTGCACTGGCCC No data
Right 1075106492 10:119542993-119543015 ACTTAGTAGCCCCGCGGAGGCGG No data
1075106476_1075106492 29 Left 1075106476 10:119542941-119542963 CCCGCGCCTGGGATAAGGTGCAC No data
Right 1075106492 10:119542993-119543015 ACTTAGTAGCCCCGCGGAGGCGG No data
1075106477_1075106492 28 Left 1075106477 10:119542942-119542964 CCGCGCCTGGGATAAGGTGCACT No data
Right 1075106492 10:119542993-119543015 ACTTAGTAGCCCCGCGGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075106492 Original CRISPR ACTTAGTAGCCCCGCGGAGG CGG Intergenic