ID: 1075106498

View in Genome Browser
Species Human (GRCh38)
Location 10:119543009-119543031
Sequence GAGGCGGTTAGCGCGTCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075106488_1075106498 2 Left 1075106488 10:119542984-119543006 CCGCCGGGAACTTAGTAGCCCCG No data
Right 1075106498 10:119543009-119543031 GAGGCGGTTAGCGCGTCCCGGGG No data
1075106483_1075106498 18 Left 1075106483 10:119542968-119542990 CCAGAGGGAGCCCGCGCCGCCGG No data
Right 1075106498 10:119543009-119543031 GAGGCGGTTAGCGCGTCCCGGGG No data
1075106482_1075106498 19 Left 1075106482 10:119542967-119542989 CCCAGAGGGAGCCCGCGCCGCCG No data
Right 1075106498 10:119543009-119543031 GAGGCGGTTAGCGCGTCCCGGGG No data
1075106487_1075106498 7 Left 1075106487 10:119542979-119543001 CCGCGCCGCCGGGAACTTAGTAG No data
Right 1075106498 10:119543009-119543031 GAGGCGGTTAGCGCGTCCCGGGG No data
1075106489_1075106498 -1 Left 1075106489 10:119542987-119543009 CCGGGAACTTAGTAGCCCCGCGG No data
Right 1075106498 10:119543009-119543031 GAGGCGGTTAGCGCGTCCCGGGG No data
1075106486_1075106498 8 Left 1075106486 10:119542978-119543000 CCCGCGCCGCCGGGAACTTAGTA No data
Right 1075106498 10:119543009-119543031 GAGGCGGTTAGCGCGTCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075106498 Original CRISPR GAGGCGGTTAGCGCGTCCCG GGG Intergenic