ID: 1075106499

View in Genome Browser
Species Human (GRCh38)
Location 10:119543016-119543038
Sequence TTAGCGCGTCCCGGGGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075106493_1075106499 -9 Left 1075106493 10:119543002-119543024 CCCCGCGGAGGCGGTTAGCGCGT No data
Right 1075106499 10:119543016-119543038 TTAGCGCGTCCCGGGGTCCCTGG No data
1075106488_1075106499 9 Left 1075106488 10:119542984-119543006 CCGCCGGGAACTTAGTAGCCCCG No data
Right 1075106499 10:119543016-119543038 TTAGCGCGTCCCGGGGTCCCTGG No data
1075106487_1075106499 14 Left 1075106487 10:119542979-119543001 CCGCGCCGCCGGGAACTTAGTAG No data
Right 1075106499 10:119543016-119543038 TTAGCGCGTCCCGGGGTCCCTGG No data
1075106486_1075106499 15 Left 1075106486 10:119542978-119543000 CCCGCGCCGCCGGGAACTTAGTA No data
Right 1075106499 10:119543016-119543038 TTAGCGCGTCCCGGGGTCCCTGG No data
1075106489_1075106499 6 Left 1075106489 10:119542987-119543009 CCGGGAACTTAGTAGCCCCGCGG No data
Right 1075106499 10:119543016-119543038 TTAGCGCGTCCCGGGGTCCCTGG No data
1075106494_1075106499 -10 Left 1075106494 10:119543003-119543025 CCCGCGGAGGCGGTTAGCGCGTC No data
Right 1075106499 10:119543016-119543038 TTAGCGCGTCCCGGGGTCCCTGG No data
1075106482_1075106499 26 Left 1075106482 10:119542967-119542989 CCCAGAGGGAGCCCGCGCCGCCG No data
Right 1075106499 10:119543016-119543038 TTAGCGCGTCCCGGGGTCCCTGG No data
1075106483_1075106499 25 Left 1075106483 10:119542968-119542990 CCAGAGGGAGCCCGCGCCGCCGG No data
Right 1075106499 10:119543016-119543038 TTAGCGCGTCCCGGGGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075106499 Original CRISPR TTAGCGCGTCCCGGGGTCCC TGG Intergenic