ID: 1075112667

View in Genome Browser
Species Human (GRCh38)
Location 10:119599981-119600003
Sequence TCTCTCCTTCCCTGATGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075112667_1075112671 -8 Left 1075112667 10:119599981-119600003 CCTGGGCATCAGGGAAGGAGAGA No data
Right 1075112671 10:119599996-119600018 AGGAGAGAGGGATGAATAGGTGG 0: 3
1: 13
2: 73
3: 326
4: 1815
1075112667_1075112673 13 Left 1075112667 10:119599981-119600003 CCTGGGCATCAGGGAAGGAGAGA No data
Right 1075112673 10:119600017-119600039 GGAACACAGGTCATTTTTACTGG No data
1075112667_1075112672 0 Left 1075112667 10:119599981-119600003 CCTGGGCATCAGGGAAGGAGAGA No data
Right 1075112672 10:119600004-119600026 GGGATGAATAGGTGGAACACAGG 0: 8
1: 25
2: 108
3: 259
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075112667 Original CRISPR TCTCTCCTTCCCTGATGCCC AGG (reversed) Intergenic
No off target data available for this crispr