ID: 1075112750

View in Genome Browser
Species Human (GRCh38)
Location 10:119600942-119600964
Sequence GACACAAGAATGTTCATAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075112750_1075112756 30 Left 1075112750 10:119600942-119600964 CCAGCTATGAACATTCTTGTGTC No data
Right 1075112756 10:119600995-119601017 CCCTCAGCCATTAGACCACCAGG No data
1075112750_1075112751 -6 Left 1075112750 10:119600942-119600964 CCAGCTATGAACATTCTTGTGTC No data
Right 1075112751 10:119600959-119600981 TGTGTCTCCTGTGATAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075112750 Original CRISPR GACACAAGAATGTTCATAGC TGG (reversed) Intergenic
No off target data available for this crispr