ID: 1075112969

View in Genome Browser
Species Human (GRCh38)
Location 10:119602840-119602862
Sequence CTTGCAGCAGGTTCTCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075112962_1075112969 26 Left 1075112962 10:119602791-119602813 CCATGGACATGAAGACGCAGCAC No data
Right 1075112969 10:119602840-119602862 CTTGCAGCAGGTTCTCTTGGAGG No data
1075112965_1075112969 -8 Left 1075112965 10:119602825-119602847 CCACTAACTACACTCCTTGCAGC No data
Right 1075112969 10:119602840-119602862 CTTGCAGCAGGTTCTCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075112969 Original CRISPR CTTGCAGCAGGTTCTCTTGG AGG Intergenic