ID: 1075113362

View in Genome Browser
Species Human (GRCh38)
Location 10:119605818-119605840
Sequence CTTTTTGTACAGATTTGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075113362_1075113369 3 Left 1075113362 10:119605818-119605840 CCCCCCCAAATCTGTACAAAAAG No data
Right 1075113369 10:119605844-119605866 AAAAAATTATCCAGGCATGATGG No data
1075113362_1075113368 -5 Left 1075113362 10:119605818-119605840 CCCCCCCAAATCTGTACAAAAAG No data
Right 1075113368 10:119605836-119605858 AAAAGAAAAAAAAATTATCCAGG 0: 6
1: 378
2: 9957
3: 41001
4: 146740

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075113362 Original CRISPR CTTTTTGTACAGATTTGGGG GGG (reversed) Intergenic
No off target data available for this crispr