ID: 1075113909

View in Genome Browser
Species Human (GRCh38)
Location 10:119610091-119610113
Sequence CTGTAATCTCAGCTACTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 13918
Summary {0: 2, 1: 51, 2: 763, 3: 4400, 4: 8702}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075113909_1075113917 28 Left 1075113909 10:119610091-119610113 CCCTCCAGTAGCTGAGATTACAG 0: 2
1: 51
2: 763
3: 4400
4: 8702
Right 1075113917 10:119610142-119610164 TGTATTTTTTTCAGAGATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075113909 Original CRISPR CTGTAATCTCAGCTACTGGA GGG (reversed) Intergenic
Too many off-targets to display for this crispr