ID: 1075116612

View in Genome Browser
Species Human (GRCh38)
Location 10:119632158-119632180
Sequence CGCCAGGTATAGAGCCCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075116609_1075116612 -3 Left 1075116609 10:119632138-119632160 CCTGAGGGCACAGGCTGCCTCGC No data
Right 1075116612 10:119632158-119632180 CGCCAGGTATAGAGCCCTTGAGG No data
1075116607_1075116612 3 Left 1075116607 10:119632132-119632154 CCTAACCCTGAGGGCACAGGCTG No data
Right 1075116612 10:119632158-119632180 CGCCAGGTATAGAGCCCTTGAGG No data
1075116608_1075116612 -2 Left 1075116608 10:119632137-119632159 CCCTGAGGGCACAGGCTGCCTCG No data
Right 1075116612 10:119632158-119632180 CGCCAGGTATAGAGCCCTTGAGG No data
1075116605_1075116612 8 Left 1075116605 10:119632127-119632149 CCAGTCCTAACCCTGAGGGCACA No data
Right 1075116612 10:119632158-119632180 CGCCAGGTATAGAGCCCTTGAGG No data
1075116602_1075116612 29 Left 1075116602 10:119632106-119632128 CCTGAAATAGTCTTGGGGCTACC No data
Right 1075116612 10:119632158-119632180 CGCCAGGTATAGAGCCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075116612 Original CRISPR CGCCAGGTATAGAGCCCTTG AGG Intergenic
No off target data available for this crispr