ID: 1075118127

View in Genome Browser
Species Human (GRCh38)
Location 10:119644232-119644254
Sequence CTCAAACATAAGTGAATCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075118127_1075118130 -3 Left 1075118127 10:119644232-119644254 CCGTTGATTCACTTATGTTTGAG No data
Right 1075118130 10:119644252-119644274 GAGCTCCTGGTTAATAGCGTGGG No data
1075118127_1075118129 -4 Left 1075118127 10:119644232-119644254 CCGTTGATTCACTTATGTTTGAG No data
Right 1075118129 10:119644251-119644273 TGAGCTCCTGGTTAATAGCGTGG No data
1075118127_1075118132 3 Left 1075118127 10:119644232-119644254 CCGTTGATTCACTTATGTTTGAG No data
Right 1075118132 10:119644258-119644280 CTGGTTAATAGCGTGGGATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075118127 Original CRISPR CTCAAACATAAGTGAATCAA CGG (reversed) Intergenic
No off target data available for this crispr