ID: 1075119828

View in Genome Browser
Species Human (GRCh38)
Location 10:119656566-119656588
Sequence TCCAGAGCCCCTTGTTTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075119826_1075119828 -4 Left 1075119826 10:119656547-119656569 CCGGCCGTCTGAGGCAGGCTCCA 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1075119828 10:119656566-119656588 TCCAGAGCCCCTTGTTTTGCAGG No data
1075119823_1075119828 4 Left 1075119823 10:119656539-119656561 CCCATCAGCCGGCCGTCTGAGGC 0: 1
1: 0
2: 1
3: 1
4: 29
Right 1075119828 10:119656566-119656588 TCCAGAGCCCCTTGTTTTGCAGG No data
1075119821_1075119828 9 Left 1075119821 10:119656534-119656556 CCATGCCCATCAGCCGGCCGTCT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1075119828 10:119656566-119656588 TCCAGAGCCCCTTGTTTTGCAGG No data
1075119824_1075119828 3 Left 1075119824 10:119656540-119656562 CCATCAGCCGGCCGTCTGAGGCA 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1075119828 10:119656566-119656588 TCCAGAGCCCCTTGTTTTGCAGG No data
1075119820_1075119828 12 Left 1075119820 10:119656531-119656553 CCACCATGCCCATCAGCCGGCCG 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1075119828 10:119656566-119656588 TCCAGAGCCCCTTGTTTTGCAGG No data
1075119827_1075119828 -8 Left 1075119827 10:119656551-119656573 CCGTCTGAGGCAGGCTCCAGAGC 0: 1
1: 0
2: 2
3: 23
4: 247
Right 1075119828 10:119656566-119656588 TCCAGAGCCCCTTGTTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075119828 Original CRISPR TCCAGAGCCCCTTGTTTTGC AGG Intronic
No off target data available for this crispr