ID: 1075125540

View in Genome Browser
Species Human (GRCh38)
Location 10:119696158-119696180
Sequence CTGATTAATTTGAAGAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075125540_1075125541 6 Left 1075125540 10:119696158-119696180 CCATCTTTCTTCAAATTAATCAG No data
Right 1075125541 10:119696187-119696209 CAAATCATCTTGCACCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075125540 Original CRISPR CTGATTAATTTGAAGAAAGA TGG (reversed) Intergenic
No off target data available for this crispr