ID: 1075127022

View in Genome Browser
Species Human (GRCh38)
Location 10:119708577-119708599
Sequence CATCACCAGGTGCCACAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075127022_1075127031 19 Left 1075127022 10:119708577-119708599 CCAGTTTGTGGCACCTGGTGATG No data
Right 1075127031 10:119708619-119708641 ACAGGGAGCAGTGCAGGGATAGG No data
1075127022_1075127030 14 Left 1075127022 10:119708577-119708599 CCAGTTTGTGGCACCTGGTGATG No data
Right 1075127030 10:119708614-119708636 CTGATACAGGGAGCAGTGCAGGG No data
1075127022_1075127029 13 Left 1075127022 10:119708577-119708599 CCAGTTTGTGGCACCTGGTGATG No data
Right 1075127029 10:119708613-119708635 GCTGATACAGGGAGCAGTGCAGG No data
1075127022_1075127025 1 Left 1075127022 10:119708577-119708599 CCAGTTTGTGGCACCTGGTGATG No data
Right 1075127025 10:119708601-119708623 CAGCCCTAGAGAGCTGATACAGG No data
1075127022_1075127026 2 Left 1075127022 10:119708577-119708599 CCAGTTTGTGGCACCTGGTGATG No data
Right 1075127026 10:119708602-119708624 AGCCCTAGAGAGCTGATACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075127022 Original CRISPR CATCACCAGGTGCCACAAAC TGG (reversed) Intergenic
No off target data available for this crispr