ID: 1075129545

View in Genome Browser
Species Human (GRCh38)
Location 10:119726234-119726256
Sequence CGCCGCCTCCCTGGGCGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 246}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075129532_1075129545 10 Left 1075129532 10:119726201-119726223 CCGACTAGGACGCCCCGTGCGCC 0: 1
1: 0
2: 0
3: 2
4: 21
Right 1075129545 10:119726234-119726256 CGCCGCCTCCCTGGGCGCGCGGG 0: 1
1: 0
2: 2
3: 26
4: 246
1075129531_1075129545 16 Left 1075129531 10:119726195-119726217 CCTCGACCGACTAGGACGCCCCG 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1075129545 10:119726234-119726256 CGCCGCCTCCCTGGGCGCGCGGG 0: 1
1: 0
2: 2
3: 26
4: 246
1075129537_1075129545 -4 Left 1075129537 10:119726215-119726237 CCGTGCGCCGCCCGCGGGCCGCC 0: 1
1: 0
2: 6
3: 31
4: 373
Right 1075129545 10:119726234-119726256 CGCCGCCTCCCTGGGCGCGCGGG 0: 1
1: 0
2: 2
3: 26
4: 246
1075129536_1075129545 -3 Left 1075129536 10:119726214-119726236 CCCGTGCGCCGCCCGCGGGCCGC 0: 1
1: 0
2: 2
3: 22
4: 260
Right 1075129545 10:119726234-119726256 CGCCGCCTCCCTGGGCGCGCGGG 0: 1
1: 0
2: 2
3: 26
4: 246
1075129535_1075129545 -2 Left 1075129535 10:119726213-119726235 CCCCGTGCGCCGCCCGCGGGCCG 0: 1
1: 0
2: 1
3: 22
4: 255
Right 1075129545 10:119726234-119726256 CGCCGCCTCCCTGGGCGCGCGGG 0: 1
1: 0
2: 2
3: 26
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075129545 Original CRISPR CGCCGCCTCCCTGGGCGCGC GGG Exonic
900162837 1:1232443-1232465 CGCCGCCTTCCTGGCAGTGCTGG + Exonic
900349743 1:2228685-2228707 CGCCGCCGCCCCGCGCGCCCCGG - Exonic
900654244 1:3747194-3747216 CGCCGCCTGCCCAGGCGGGCCGG - Intergenic
900786949 1:4655295-4655317 CGCCGCCTCCCGCCGCCCGCCGG - Exonic
901057404 1:6455108-6455130 CGCCGCCGCCCACGGCCCGCTGG + Intronic
901251781 1:7784518-7784540 GGCCCCATCCCTCGGCGCGCGGG + Intronic
901483089 1:9539556-9539578 CAACGCCTCCATGCGCGCGCGGG - Exonic
902476955 1:16693371-16693393 CGCCGCCGCCCACGGCCCGCTGG - Intergenic
903032889 1:20476304-20476326 CGCGGCCTCCCTGCCCCCGCAGG - Intergenic
903846433 1:26282197-26282219 CGCCCCCTCCCTGGCCCAGCTGG + Intronic
904009834 1:27383228-27383250 CGGAGCCTCCATGGGCTCGCGGG + Exonic
904253031 1:29237951-29237973 CGCCCCCTCCCTTGGCGCGCAGG + Intronic
904479537 1:30785360-30785382 AGCCGCCTTGCTGGGCGGGCAGG - Intergenic
905027357 1:34859795-34859817 CGCCGGCTCTCTCGGAGCGCAGG + Exonic
905137147 1:35808407-35808429 CGCCGCCGCCATGGAGGCGCTGG + Exonic
905734602 1:40316750-40316772 CGCCGCCTCCCAGGGGGCGCCGG - Intronic
906004436 1:42456643-42456665 CGCGGCCAGGCTGGGCGCGCAGG + Exonic
906106292 1:43294873-43294895 AGCAGCCTCCCTGGGTGTGCTGG + Intergenic
906961419 1:50421483-50421505 CGCCGCCGCCGTCGCCGCGCCGG + Exonic
906962544 1:50427148-50427170 CACCCCTTCCCTGGCCGCGCCGG + Intergenic
911497781 1:98651368-98651390 CCCCGCCTCCCTGGGCAAGCTGG - Intergenic
912471706 1:109911144-109911166 AGCCGACAGCCTGGGCGCGCCGG + Intronic
913186357 1:116373532-116373554 AGCCCCCTCCCCGGGCGCGCCGG - Intronic
913975322 1:143450791-143450813 CGCCGGGTCCCGGAGCGCGCGGG + Intergenic
914069714 1:144276407-144276429 CGCCGGGTCCCGGAGCGCGCGGG + Intergenic
914109441 1:144689947-144689969 CGCCGGGTCCCGGAGCGCGCGGG - Intergenic
914803055 1:150974467-150974489 CGCCGCCTCCCTCCTCGCCCCGG + Intronic
916022132 1:160802075-160802097 CGCCGCCTCCCATGGCACGTCGG + Intronic
916436723 1:164784381-164784403 CTGCGCCTCCCTGGGCCAGCTGG - Intronic
919739260 1:200972491-200972513 CCCCGCCTTCCCGGGGGCGCTGG + Intronic
922792214 1:228316778-228316800 CACCGCCTCGCTGAGCGTGCAGG - Exonic
923171483 1:231421598-231421620 CGCTGCCTTCCTGGGCTCCCGGG + Exonic
924482595 1:244451174-244451196 CTCCGCCGCCCTGGGCGGGGCGG + Intronic
1063407695 10:5813028-5813050 CCCCGCGTCCCGGGGCGAGCGGG - Intronic
1064167792 10:13001582-13001604 CGCCGCCGCCCCGTGCGCCCCGG - Exonic
1064982018 10:21174361-21174383 CGCCGCCCACCTGGGCTCCCCGG - Intergenic
1070280379 10:75044008-75044030 CGCCGTCGCCCTGGGCGCAGGGG + Exonic
1072107849 10:92291138-92291160 CGCCGCCTCCGTGCGCGCCAGGG - Intergenic
1075129545 10:119726234-119726256 CGCCGCCTCCCTGGGCGCGCGGG + Exonic
1075645191 10:124092416-124092438 CGCCGCCTCCCGAGACGCGGCGG + Intronic
1076571486 10:131436106-131436128 CTTCGCCTCCCTGGGAGGGCGGG - Intergenic
1076661490 10:132058543-132058565 GGCCGCTCCCCTGGGCACGCAGG + Intergenic
1076858508 10:133128848-133128870 CGCCGCCTGCCTGCACTCGCCGG + Exonic
1076986041 11:236501-236523 CTACGTCTACCTGGGCGCGCCGG - Intronic
1077282837 11:1753370-1753392 CGCCGGCTTCCAGGGCGCCCAGG + Exonic
1077962493 11:7089729-7089751 CGACCCCTACCTGGGCCCGCGGG + Exonic
1078090805 11:8263276-8263298 CGCCCCCTGCCGCGGCGCGCAGG - Intronic
1081969192 11:47186427-47186449 CGCGGCCTCCCGGAGCGCGCCGG + Intronic
1082076675 11:47980667-47980689 GGCCGCGTCCCTGAGCGCGCAGG - Exonic
1082205993 11:49434553-49434575 CAACGCCTCCATGCGCGCGCGGG + Intergenic
1084546228 11:69816451-69816473 CGCCCCCTCCGTGGGGGCGGCGG - Intronic
1086087514 11:82970639-82970661 AGCCGGCTCCCTGGGCTTGCGGG + Intergenic
1088764209 11:112961157-112961179 CGCAGTCTCCCTGGGAGAGCTGG - Intergenic
1089292289 11:117444540-117444562 CCCCTCCTCCCTGGACGGGCGGG - Intronic
1089848719 11:121479198-121479220 CTCCACCTCCCTGGGGGCCCAGG - Intronic
1090226341 11:125074336-125074358 CTCCACCTGCCTGGGCGCACAGG - Intronic
1090884253 11:130862050-130862072 CGCCGCATCCCCGGGTGCGGAGG - Intergenic
1090977813 11:131691391-131691413 CGTGGACTCCCTGGGCGCACGGG - Intronic
1091565644 12:1646051-1646073 CACGGGCTCCCTGGGCACGCAGG + Exonic
1091718416 12:2795540-2795562 CTCCGCCGCCCCGCGCGCGCCGG - Intronic
1092485411 12:8898489-8898511 CTCCGCCTCGCCGGGCGCGGTGG + Intergenic
1096106515 12:48999339-48999361 CGCCGGCTCCCTGGGCTGGGAGG - Intergenic
1098819465 12:75209355-75209377 AGCCGCTTCCCTGGGCGCTGGGG + Exonic
1103364012 12:120369332-120369354 CGCCGCCTCCGCGGGCGCCCGGG - Intergenic
1104980521 12:132571368-132571390 TGGCGCCTCCCTGGGCCCGGGGG + Exonic
1105000727 12:132688077-132688099 CGTGGCTTCCCCGGGCGCGCGGG - Intronic
1105015826 12:132786402-132786424 CGCAGCCTCCTTGGCCGCGAGGG + Exonic
1105725735 13:23160413-23160435 CCCCGCCTCCCCGCGCGCCCCGG + Intergenic
1106242012 13:27920288-27920310 CCCTGGCGCCCTGGGCGCGCTGG + Exonic
1108313930 13:49220299-49220321 CGCCGCGTCCCGGGTCGGGCTGG - Intergenic
1108408811 13:50127895-50127917 CGCACCCTCGCTGGGCGAGCCGG - Intronic
1108662603 13:52600326-52600348 CGCCGCTTCCCTGGACGCCCGGG + Intergenic
1113201007 13:107867379-107867401 CGCCGCCTCCCGCGGAGCTCCGG + Intergenic
1113562304 13:111291452-111291474 CCCCTGCTCCCAGGGCGCGCTGG - Intronic
1116186640 14:41607080-41607102 CACCGCCTCCCTGCGCGCCGCGG - Intergenic
1117392052 14:55271625-55271647 CGCCGCCTGCCTGCGCTCCCGGG + Intronic
1117478133 14:56118202-56118224 CGCCCCCTCCCCCGGCGCGTGGG - Intronic
1117549096 14:56816762-56816784 CGCCGCCCCGCTGGAGGCGCCGG + Intergenic
1118796675 14:69151677-69151699 CCCCTCCTCCCTGGGGTCGCGGG - Intronic
1119296497 14:73537580-73537602 CGCCGACACCCTTGGCGAGCTGG + Exonic
1122231199 14:100306975-100306997 CACCGCCGCCGCGGGCGCGCAGG - Intergenic
1122688942 14:103522593-103522615 GGCCGCGTCCCGGGGGGCGCCGG - Intronic
1127211534 15:56779592-56779614 AGCCGGCTCCCTGGGCTTGCGGG + Intronic
1129273945 15:74433443-74433465 CGCCCCCTCCCCTGGCGCCCGGG + Intronic
1131257501 15:90871874-90871896 CGCAGCCCACCTGAGCGCGCCGG + Intronic
1131272407 15:90955240-90955262 CGTCGCCGCCCGGGGCGCGGCGG - Intronic
1131692781 15:94844994-94845016 CGCCGCCTCCCGCCGCGCTCGGG - Intergenic
1132484171 16:181574-181596 CGCCCCCTCCCGGCGCGAGCCGG + Intergenic
1132500068 16:281147-281169 CGCCGCCTCCCATGGCGCCCCGG - Intronic
1132580082 16:680694-680716 CGCCGCCGCCCTCCCCGCGCGGG - Intronic
1135415725 16:22266783-22266805 CGCAGCCAACCTGGGCGAGCTGG + Exonic
1136278032 16:29191101-29191123 CGCCGGCTGCCTGTGCGCCCTGG - Intergenic
1136366779 16:29812586-29812608 CCCCTCCTCCCTGGGCTCCCAGG - Intronic
1141471016 16:84238544-84238566 CTCCCCCTCTCTGGGCCCGCAGG + Intronic
1142049873 16:87951362-87951384 CGCAGGCTCACTGGGCGCGCGGG - Intronic
1142068524 16:88076372-88076394 CGGAGCCTCCCTGGGCGCCAGGG + Intronic
1142472806 17:172599-172621 CGCAGCTGCCCTGGGCACGCTGG - Exonic
1142855006 17:2724414-2724436 CTCCGGGTCCCCGGGCGCGCTGG + Intergenic
1143247815 17:5500825-5500847 CGACGCCGACCTGGGCCCGCGGG + Intronic
1143373750 17:6455604-6455626 CGCCGCACACCTGGCCGCGCTGG - Exonic
1143419255 17:6776221-6776243 CGCCAACTCCATGGGCGCCCCGG - Exonic
1144519787 17:15945842-15945864 CGGCGCCTCCCCGGGCGCCGGGG - Intronic
1145243575 17:21253225-21253247 CGCCGTGCCGCTGGGCGCGCTGG - Exonic
1146393638 17:32444628-32444650 CGCCGCCTCCCCGGCCCCGCCGG + Intronic
1146723938 17:35142318-35142340 CGCCGTCTCCGTGGTCGGGCGGG + Intergenic
1147168214 17:38604513-38604535 AGCCTCCTCCCTGGGAGAGCGGG + Intronic
1147193324 17:38749277-38749299 GTGCGCCTCCCTGGGCGCGCGGG + Intronic
1147377059 17:40028779-40028801 CGCAGCCTCCCTGCACGCCCTGG + Intronic
1147648816 17:42050491-42050513 CGCCCCCTCCCGGAGCGGGCGGG - Intronic
1147971539 17:44220994-44221016 CGCCGCCTCCCGGGCCACCCCGG + Intronic
1151370868 17:73645318-73645340 CGCCGCCCCTCCCGGCGCGCAGG - Intergenic
1151992964 17:77590268-77590290 CGCCTCCTCCCTGAGCAGGCTGG - Intergenic
1152095992 17:78271882-78271904 GGCAGCCTCCCTGAGCGAGCAGG - Intergenic
1152654459 17:81513326-81513348 CTCTGCGTCCCTGGGCGCGGGGG + Intronic
1154377423 18:13821865-13821887 CGCAGCCTCCCTGAGAGCCCTGG - Intergenic
1156471246 18:37378347-37378369 TGCCCCCTCCCTGGGCTCCCTGG - Intronic
1157476874 18:48029300-48029322 GCCGGCCTCCCTGGGCTCGCCGG - Exonic
1157496777 18:48162007-48162029 CGGCGCCTGCCCGGGCGGGCGGG + Intronic
1157595823 18:48863023-48863045 GGCCGCCTCCCTGAGCCGGCTGG + Intronic
1160453356 18:78979805-78979827 CGCCGTCTCCGCCGGCGCGCCGG - Intergenic
1160856776 19:1221361-1221383 CCCCGCCTCCCTGGGGCTGCGGG - Intronic
1160866978 19:1260416-1260438 CGCCCCCTCGCTGGGCGGGGTGG + Intronic
1160888751 19:1365774-1365796 GGCAGCCTCCCTGAGAGCGCAGG + Intronic
1160921856 19:1524336-1524358 CGGCGCGTCCCTGCGAGCGCGGG + Intronic
1161135453 19:2616937-2616959 CTCCGCCTCCCTGGTCATGCAGG + Intronic
1161153541 19:2721294-2721316 GGCCGCCTACCTGGGCCCGCTGG + Exonic
1161345921 19:3768656-3768678 GGCGGCCTCCCTGGGCAGGCGGG + Intergenic
1161583594 19:5093440-5093462 CGCCGGCTCCCAGGGCTCCCTGG - Intronic
1162315604 19:9936475-9936497 CGCCGCCTCCCCCGCCTCGCCGG + Exonic
1162572638 19:11481872-11481894 CGCAGCCTCCTTTGGTGCGCGGG + Intronic
1162959491 19:14117616-14117638 CGCCGCCGCCCAGCGCGCTCCGG - Exonic
1163453239 19:17391225-17391247 CGCCGCCTCCCGGGCCGCACAGG + Intergenic
1163453261 19:17391318-17391340 CGCCGCCTCCCAGCGCGCCAGGG + Intergenic
1163462632 19:17448231-17448253 GGCCGCCGCGCTGGCCGCGCTGG - Exonic
1163607096 19:18281486-18281508 CTCCGCCTCCCCCGCCGCGCCGG + Exonic
1163609351 19:18292921-18292943 GGCGGCCTCGCTGGGCGGGCGGG - Intergenic
1163806950 19:19405510-19405532 CGACACCTCGTTGGGCGCGCTGG - Intronic
1165309775 19:35022993-35023015 GGCCACCTCCCTGGGGGAGCTGG - Intronic
1166219130 19:41353898-41353920 CGCCGCCGCCCTTCGCGCCCTGG - Exonic
1166367387 19:42284432-42284454 CCCCGCCCCCCGGCGCGCGCGGG - Intronic
1166869784 19:45864306-45864328 GGCCGCCTCCCGCGGCGCTCGGG + Exonic
1167220400 19:48195371-48195393 CACCGCCTCCCCGGCCGCGTCGG - Exonic
1167377672 19:49120241-49120263 CGCCCCCTCCCTGGTGGCGGCGG - Intronic
1167591088 19:50404837-50404859 CTCCGCCTCCCAGGGGGCGCTGG + Intronic
1167792189 19:51689523-51689545 CTCCGCCGCCCCGGGCCCGCAGG - Intergenic
1168092463 19:54095274-54095296 CCTCATCTCCCTGGGCGCGCTGG - Exonic
1168544688 19:57240674-57240696 GGCCGCCTCCCTGGCGGCGCTGG + Intronic
1202710971 1_KI270714v1_random:19197-19219 CGCCGCCGCCCACGGCCCGCTGG - Intergenic
925128421 2:1477619-1477641 CGCAGCCACCCAGGGCGCCCAGG - Intronic
925413890 2:3656182-3656204 CCCGGCCTCCCTGGGCTCCCAGG - Intergenic
925447577 2:3941076-3941098 CACCGCCTCCCTTGGCGGCCAGG + Intergenic
925725191 2:6865318-6865340 CGCCGCCGGCCTGGCCGCCCGGG + Exonic
926914434 2:17878822-17878844 CCCCACCTCCCTGCGCGCTCCGG + Intronic
928617990 2:33057821-33057843 AGCCGCCTCCCTCGGCTTGCGGG - Intronic
929647051 2:43637753-43637775 CGCGGCATCCCTGACCGCGCGGG - Intronic
929681307 2:43995853-43995875 CGCCTCCTCCCTGGCGGCCCGGG - Exonic
932036651 2:68252626-68252648 CGCCGCCCAGCGGGGCGCGCAGG - Intronic
934180022 2:89611764-89611786 CGCCGGGTCCCGGAGCGCGCGGG + Intergenic
934290317 2:91686025-91686047 CGCCGGGTCCCGGAGCGCGCGGG + Intergenic
936518800 2:113198993-113199015 CGCCGCCCCCCTGGCCGCCTCGG - Intronic
937908664 2:127064865-127064887 AGCCCCTTCCCTGGGCGGGCTGG - Intronic
941020847 2:160407265-160407287 CGCCGCCGCCCGGGCCGGGCAGG - Intronic
941951491 2:171160826-171160848 CGCCGCCTCCCGGGCGACGCCGG - Exonic
942346079 2:175004798-175004820 CGCCCCCTCCCCGGGCGCCCAGG + Intronic
942346272 2:175005506-175005528 GGCCGCCTCCAGGGGGGCGCTGG - Intergenic
944676001 2:202034436-202034458 CGCCGCCGCCCTGCACTCGCAGG - Intergenic
948047007 2:234952371-234952393 CGCCGCTCCCCCGGGCGCTCGGG + Intronic
949052020 2:241902599-241902621 CCCCGACTCCCTGGGCTCCCGGG - Intergenic
1168904591 20:1392986-1393008 CGCCGCCGCCATGGGAGTGCAGG - Exonic
1168962959 20:1881407-1881429 CCACGCCTCCCTGGGCCTGCAGG + Intergenic
1169266845 20:4172249-4172271 CGCCGCCACCCTGGGCACCCTGG - Intronic
1172028950 20:31968255-31968277 CGCCGCCTCCCCGCGCCCGCCGG - Exonic
1172100706 20:32483031-32483053 CCCCGCGACCCTGGGCGCTCAGG + Intronic
1174317476 20:49713791-49713813 CACCGCCTCCCGGGCCTCGCGGG + Exonic
1175831846 20:61969038-61969060 AGCCCCCTCCCTGGCGGCGCTGG - Intronic
1176546889 21:8206096-8206118 AGCCGCCTGCCGGGGCCCGCGGG + Intergenic
1176554794 21:8250305-8250327 AGCCGCCTGCCGGGGCCCGCGGG + Intergenic
1176565840 21:8389143-8389165 AGCCGCCTGCCGGGGCCCGCGGG + Intergenic
1176573715 21:8433330-8433352 AGCCGCCTGCCGGGGCCCGCGGG + Intergenic
1179561793 21:42219924-42219946 GGCCGCCTTTCTGCGCGCGCCGG + Intronic
1179893676 21:44350206-44350228 CACCGCCGCCCTGGCCCCGCGGG - Intronic
1180921708 22:19524685-19524707 GGCCGCCTCCCTGCGCGTCCCGG + Intronic
1180960679 22:19761032-19761054 CGCCGCCGCCCCCGGCGCCCCGG + Exonic
1182426489 22:30275960-30275982 CTCAGCCTCCCTGGCTGCGCCGG - Intergenic
1182692855 22:32175964-32175986 CTCCCCCTCCCCGGGCGCGCAGG - Intergenic
1183107917 22:35627905-35627927 CGCCTCCTTCCTGGGGGAGCTGG - Intronic
1183437080 22:37802539-37802561 AGCCGCCTGCCTGGGTGCCCAGG + Intergenic
1183872801 22:40753287-40753309 CGCAGCCTGCCAGGGCGAGCTGG - Intergenic
1183990309 22:41593492-41593514 CGCCGGCTCCCTCGGCTTGCGGG + Intergenic
1185259477 22:49853718-49853740 CGCCTCGTCCCTGGCCGGGCGGG - Intergenic
1203251764 22_KI270733v1_random:122381-122403 AGCCGCCTGCCGGGGCCCGCGGG + Intergenic
1203259814 22_KI270733v1_random:167463-167485 AGCCGCCTGCCGGGGCCCGCGGG + Intergenic
950168026 3:10816206-10816228 CGCCGCCGCCCCGGGCGAGCTGG - Exonic
950550107 3:13661216-13661238 GGCAGCCTCTCTGGGCTCGCAGG + Intergenic
953598232 3:44338069-44338091 CGCCCCCTGCCAGGGCGCCCGGG + Intergenic
954295956 3:49674557-49674579 CGCCGCCTGCCTGGGCCCGGAGG + Exonic
954624879 3:52016894-52016916 CTCCCCCTCCCTGGGTGCTCTGG + Intergenic
954733591 3:52685960-52685982 CACCGCCTCTCTGCGTGCGCGGG - Exonic
954779071 3:53046019-53046041 CGCCGCCTCCGCCGGAGCGCGGG - Exonic
955057558 3:55470271-55470293 CACCGGCTCGCTGGGCACGCAGG - Exonic
959085639 3:101849142-101849164 CGCCCTCTCCCCGGGCGCCCAGG + Intronic
966933029 3:184687881-184687903 GGGCCCCTCCCCGGGCGCGCGGG + Intergenic
967904101 3:194486792-194486814 CGCCGCCGCCGCGGGCGCGGAGG - Intronic
968092777 3:195909004-195909026 CGGCCCCTCCCTGCGCTCGCGGG + Intronic
968659635 4:1793702-1793724 CGCCGCCGCCCAGGGCTCCCGGG - Intronic
971244029 4:24912735-24912757 CTCGGCCTCTCTGGGGGCGCGGG + Intronic
972437191 4:39045184-39045206 TGCGGCCTCCCGGAGCGCGCGGG + Intronic
976431289 4:84966158-84966180 CACCGCCTCTCCGGGAGCGCGGG + Intronic
976597033 4:86904302-86904324 AGCCGGCTCCCTGTGCTCGCGGG - Intronic
984260881 4:177442518-177442540 CGAGGCGTCCCTGGGCCCGCGGG + Intergenic
990210784 5:53480230-53480252 ACCCGCCACCCCGGGCGCGCCGG + Intergenic
992052846 5:72956503-72956525 AGCCGCCTCCCGCTGCGCGCTGG + Intronic
992093257 5:73338336-73338358 CTCCGCCTGCCTGGGAGCCCTGG - Intergenic
992269785 5:75053045-75053067 AGCCGGCTTCCTGGGCTCGCGGG - Intergenic
992837418 5:80654616-80654638 CGCCGCGACCCTGCGTGCGCCGG - Exonic
997238959 5:132293597-132293619 CGCCGGGTCCATGGGCGGGCGGG - Intronic
997586900 5:135048715-135048737 CGCCCCCTCCATGGGCCCTCAGG + Intronic
1001771667 5:174301622-174301644 CGCCCCCTCCCTTGTCCCGCTGG + Intergenic
1002277426 5:178113324-178113346 CGCTGCCTCCTTGAGCGCCCCGG - Intergenic
1003778730 6:9398857-9398879 CGCCCCCACCCTGCGCTCGCTGG - Intergenic
1004220564 6:13743171-13743193 AGCCGGCTCCCTGGGCTTGCAGG + Intergenic
1006313440 6:33277272-33277294 CCCCGCCCCCCAGGGTGCGCTGG + Exonic
1007701770 6:43770112-43770134 CCCCGCCCCCCGGGGCGGGCCGG + Intergenic
1007849753 6:44791791-44791813 CGCCCCCTCCTTGGGGGAGCGGG - Intergenic
1008308314 6:49933646-49933668 AGCCGGCTCCCTGGGCTTGCGGG + Intergenic
1009437589 6:63635905-63635927 CGCCGCCGCCCTGAGCCCGAAGG - Exonic
1014741749 6:125154565-125154587 CTCTGCCTCCCGTGGCGCGCGGG + Intronic
1015625936 6:135181191-135181213 CGCCGCCTCCGCGGTCGCCCTGG - Intergenic
1019343014 7:517363-517385 CGCCCCTTCCCTCCGCGCGCGGG - Intronic
1019500862 7:1364193-1364215 CGCTGCCTTCCTGGGCGTGCTGG + Intergenic
1019635623 7:2074180-2074202 CGCAGCCAGCCTGGGCTCGCTGG + Intronic
1019685623 7:2380334-2380356 CGCCTCCTCCCTGTGCTCTCTGG + Exonic
1023319307 7:38976081-38976103 CACCGCCCTCCTGGGCGCCCGGG - Intergenic
1023773693 7:43583344-43583366 CGCCGCCGCCCCAGGCCCGCGGG + Exonic
1024499820 7:50093151-50093173 CGCCGCCTGCCCCGCCGCGCTGG + Exonic
1029494650 7:100890342-100890364 TCCCGCCTCGCTGGGCGCCCTGG - Exonic
1029639821 7:101814103-101814125 CGCCGCCTCCCCGAGTGTGCAGG + Intergenic
1034432735 7:151049251-151049273 CGCCGCCTTCCTGCGCGCCCTGG + Exonic
1034470511 7:151252032-151252054 CGCCGCCTCCCCGGCCGCCGCGG - Intronic
1034503827 7:151469510-151469532 TGCCTCCTCCCTGGGAGGGCCGG - Intronic
1035580666 8:737724-737746 CGACGGCTCCCGGGGCTCGCGGG - Intronic
1037811375 8:22089146-22089168 CCCCGCCCCCCTCGTCGCGCCGG + Intronic
1038039723 8:23714547-23714569 CGCCGCCTCTCTGGCCGCTGAGG - Intergenic
1038338157 8:26661936-26661958 GGCCGCTTCCCTGGGGCCGCTGG - Intergenic
1038798157 8:30727581-30727603 CTCGGCCGCCCTGCGCGCGCTGG + Exonic
1038883712 8:31640436-31640458 CGCCTCCTCCCCGGGCTCGCCGG - Intronic
1041275892 8:56157262-56157284 CGCCGCTTTCCCTGGCGCGCGGG - Intergenic
1043390133 8:79784112-79784134 CGGGCCCTCCCTGGGCGGGCGGG + Intergenic
1045115288 8:98974095-98974117 CGCAGCCTCCCTGGGGACACTGG - Intergenic
1048981302 8:139704360-139704382 CGCCCCCTCCCTGGCGGCTCAGG - Intergenic
1049688753 8:143949742-143949764 GGCCGCCTCCCTTGCCGCGGGGG - Intronic
1049802503 8:144524602-144524624 CGCCGGCCTCCAGGGCGCGCAGG + Exonic
1051171540 9:14322596-14322618 CACGGCCGGCCTGGGCGCGCGGG + Intronic
1054835650 9:69672545-69672567 CGCCGCCGCCGCGGGCTCGCGGG - Intergenic
1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG + Exonic
1057489641 9:95511127-95511149 CGCTGGCTGCCCGGGCGCGCTGG + Intronic
1058157699 9:101533701-101533723 CGCCGCCTCCCTAGCAACGCTGG - Intergenic
1059176772 9:112175265-112175287 CGCCTCCTCCCGGGGCCCTCAGG + Exonic
1060106464 9:120876413-120876435 CGCCTCCACCCTGGCCGGGCGGG + Intronic
1060700725 9:125747309-125747331 CGCCCCCTCCCCGCGCGGGCGGG + Intergenic
1060734449 9:126057699-126057721 AGCGGCCTCCCTGGGCCCGGCGG + Intergenic
1061285481 9:129620230-129620252 CGCCGATTCCCGGGACGCGCCGG + Exonic
1061828441 9:133275546-133275568 CCCCGCCTCCCCGGGGGAGCAGG - Intergenic
1061861126 9:133469299-133469321 CCCCTCCTCCCTGGGCCTGCTGG + Exonic
1061955861 9:133961016-133961038 CGACGCCTGCCTGGGAGCGCAGG + Intronic
1062142481 9:134967235-134967257 CGCAGCCTCCTTGGGGGCACTGG + Intergenic
1062162466 9:135087822-135087844 CGCCGCCGCCCCGCGCGCCCCGG - Exonic
1062162583 9:135088239-135088261 CGCCGCCTCCCTGGGCGACTCGG - Intronic
1062341584 9:136095802-136095824 CGCAGCCGCCCTGGACGCTCAGG + Intergenic
1062499179 9:136845031-136845053 CGCGGCCTCGGTGGGCCCGCAGG - Exonic
1062594950 9:137295407-137295429 CCCCGCCTCCCTGGGGCCGAGGG + Intergenic
1203468166 Un_GL000220v1:105532-105554 AGCCGCCTGCCGGGGCCCGCGGG + Intergenic
1203475987 Un_GL000220v1:149504-149526 AGCCGCCTGCCGGGGCCCGCGGG + Intergenic
1187181379 X:16946681-16946703 CGCTTCCTCCCGGCGCGCGCCGG - Exonic
1189310401 X:40013957-40013979 CGCCCCCTCCCCGGGCTCTCTGG - Intergenic