ID: 1075131264

View in Genome Browser
Species Human (GRCh38)
Location 10:119741931-119741953
Sequence AGCTACTTGGGAGCACCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19168
Summary {0: 1, 1: 0, 2: 29, 3: 979, 4: 18159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075131264_1075131271 7 Left 1075131264 10:119741931-119741953 CCACCTGGTGCTCCCAAGTAGCT 0: 1
1: 0
2: 29
3: 979
4: 18159
Right 1075131271 10:119741961-119741983 CAGGTGCTTGCCACCACGCCTGG 0: 97
1: 4531
2: 25714
3: 68880
4: 135723

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075131264 Original CRISPR AGCTACTTGGGAGCACCAGG TGG (reversed) Intronic
Too many off-targets to display for this crispr