ID: 1075131993

View in Genome Browser
Species Human (GRCh38)
Location 10:119748303-119748325
Sequence CAGTGGGGCTCTGCAGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 701
Summary {0: 1, 1: 0, 2: 70, 3: 148, 4: 482}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075131993_1075132002 11 Left 1075131993 10:119748303-119748325 CCAGGAACTGCAGAGCCCCACTG 0: 1
1: 0
2: 70
3: 148
4: 482
Right 1075132002 10:119748337-119748359 GCTCGGAGAGCCCCTAGGTCTGG No data
1075131993_1075132006 23 Left 1075131993 10:119748303-119748325 CCAGGAACTGCAGAGCCCCACTG 0: 1
1: 0
2: 70
3: 148
4: 482
Right 1075132006 10:119748349-119748371 CCTAGGTCTGGTGTTCCCGAAGG No data
1075131993_1075132000 6 Left 1075131993 10:119748303-119748325 CCAGGAACTGCAGAGCCCCACTG 0: 1
1: 0
2: 70
3: 148
4: 482
Right 1075132000 10:119748332-119748354 CCCTGGCTCGGAGAGCCCCTAGG No data
1075131993_1075132007 24 Left 1075131993 10:119748303-119748325 CCAGGAACTGCAGAGCCCCACTG 0: 1
1: 0
2: 70
3: 148
4: 482
Right 1075132007 10:119748350-119748372 CTAGGTCTGGTGTTCCCGAAGGG No data
1075131993_1075131998 -6 Left 1075131993 10:119748303-119748325 CCAGGAACTGCAGAGCCCCACTG 0: 1
1: 0
2: 70
3: 148
4: 482
Right 1075131998 10:119748320-119748342 CCACTGTCACAGCCCTGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075131993 Original CRISPR CAGTGGGGCTCTGCAGTTCC TGG (reversed) Intronic
900364922 1:2307424-2307446 CTGTGCGGCTCTGCACTTCCTGG - Exonic
900398029 1:2461274-2461296 CAGTGGGGCTCTGCAGCCCGGGG + Intronic
900971206 1:5993189-5993211 CACCGGGGCGCTGCTGTTCCCGG + Intronic
901041612 1:6367662-6367684 CTTTGGGGCCCTGCAGTTCCTGG - Intronic
901084193 1:6600909-6600931 CAGTGGGGCTCTGAGGTGTCAGG - Intronic
901223902 1:7601027-7601049 CAGAGGGGCTCCTCACTTCCCGG + Intronic
901598834 1:10406584-10406606 CAGTGAAGCTCTGCGGTTTCCGG + Intronic
901768869 1:11520611-11520633 CAGTGGGGCTCCAAAGTGCCGGG - Intronic
901936691 1:12631607-12631629 CTTTTGGGCCCTGCAGTTCCTGG + Intergenic
902644678 1:17790199-17790221 CACTGGGGCCCTGTGGTTCCTGG - Intronic
904461126 1:30680447-30680469 CTTTGGGGCCCTGCAGTTCCTGG + Intergenic
904494724 1:30880218-30880240 CTGTGGGGAGCTGCAGCTCCTGG - Intronic
904732614 1:32606348-32606370 CTTTGGGGGTCTGCAGTTCCCGG - Intronic
905230515 1:36512326-36512348 GAGAGGGGCTCTGCAGTGTCCGG + Intergenic
906051727 1:42880190-42880212 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
906155497 1:43611806-43611828 AAGGGTGGCTCTGCAGTTGCTGG + Intronic
906318242 1:44801606-44801628 CAGTGGCTCTCTGCAGTCCCTGG + Exonic
906667035 1:47629110-47629132 CAGAGGGAGTCTGCTGTTCCTGG + Intergenic
906854869 1:49293062-49293084 CTTTGGGGCCCTGCAGTTCCTGG + Intronic
906892334 1:49730564-49730586 CCTTGGGGCTCTGCAGTTGCTGG + Intronic
907255668 1:53176965-53176987 GCATGGAGCTCTGCAGTTCCAGG + Intergenic
907614891 1:55913509-55913531 CTCTGGGGCTCTGTGGTTCCTGG + Intergenic
907728331 1:57041468-57041490 CATTGTGGCTGTGCTGTTCCCGG + Intronic
907961743 1:59290201-59290223 CCTGGAGGCTCTGCAGTTCCTGG - Intergenic
909197873 1:72649458-72649480 TTTTCGGGCTCTGCAGTTCCTGG + Intergenic
909481671 1:76133314-76133336 CAGTGAGGCTCTGCAGCCACAGG - Intronic
909907916 1:81221605-81221627 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
909984706 1:82146674-82146696 CAGTGGGCTTCTGCACTGCCAGG + Intergenic
910259969 1:85284939-85284961 CTCTGGGGCTCTGTGGTTCCCGG + Intergenic
910603522 1:89057072-89057094 CAGTGGGGATCTGCCGTGCATGG - Exonic
911288615 1:96028381-96028403 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
911497577 1:98650273-98650295 CTTTGAGGCTCTGCAGTTTCTGG - Intergenic
911935048 1:103959965-103959987 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
912008743 1:104933787-104933809 CTTTGGGACTCTGCAGTTCCTGG + Intergenic
912044564 1:105437806-105437828 CTCTGGGGCTCTGCAGTTCCTGG + Intergenic
912062071 1:105686369-105686391 CTTTGAGGTTCTGCAGTTCCTGG - Intergenic
912385103 1:109267544-109267566 CAGTGGCGCACAGCAGTCCCTGG - Exonic
912881671 1:113422721-113422743 CAATAGGGTTCTGCTGTTCCTGG - Intronic
913052138 1:115126793-115126815 CCGTGAGGCTCTGCAGTCCTTGG + Intergenic
914254909 1:145953974-145953996 CACTGGAGCCCAGCAGTTCCAGG + Intronic
915592530 1:156878850-156878872 CAGTGGGCATCTGGAGTTCAAGG + Intronic
916123318 1:161548595-161548617 CAGTGTGACTCTGAAGTGCCAGG - Exonic
916133212 1:161629952-161629974 CAGTGTGACTCTGAAGTGCCAGG - Exonic
918983589 1:191595527-191595549 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
919168673 1:193927347-193927369 TTTTGGGGCTCTGCAGTTCCTGG - Intergenic
919264090 1:195238345-195238367 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
919513338 1:198493591-198493613 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
920440250 1:205975961-205975983 CAGTGGGGCTGTGCAGGGCATGG + Intergenic
920668646 1:207986130-207986152 CAGGGGGGCCCTGCCGTCCCCGG - Intergenic
920683471 1:208090869-208090891 CATGGTGGCTCTGCTGTTCCTGG + Intronic
920722428 1:208400103-208400125 CAGTTGGGCTCTGCAGTCAGAGG + Intergenic
921705898 1:218323082-218323104 CTTTAGGGCTCTGCAGTTACTGG - Intronic
922041590 1:221903315-221903337 CATTGGGGCCCTGTGGTTCCTGG - Intergenic
922141596 1:222893697-222893719 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
922874370 1:228928322-228928344 CTGCGGGGCTTTGCAGTTCATGG + Intergenic
923328248 1:232899289-232899311 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
923569146 1:235098874-235098896 CAATCGGGCTCAGGAGTTCCAGG - Intergenic
923755379 1:236786455-236786477 CTTTGGGGCCCTGCAGTTTCTGG + Intergenic
923786095 1:237070880-237070902 CCTTGGGGCTCTGCAGTTCCTGG - Intronic
924404730 1:243730748-243730770 CCTTGAGGCTCTGCAGTTGCTGG + Intronic
1063304808 10:4887341-4887363 CAGTGGGTCTCTGCAGCACATGG - Intergenic
1064010413 10:11730790-11730812 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1065055361 10:21837727-21837749 CAGAGGGGCTCCTCACTTCCCGG - Intronic
1065201371 10:23316354-23316376 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
1065709871 10:28505553-28505575 CAGTGGGGCTCTGTTGTGCCAGG - Intergenic
1066188962 10:33037707-33037729 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1067058631 10:43066462-43066484 AAGGGGGGCTCGGCAGCTCCGGG + Intergenic
1067772313 10:49135611-49135633 CCCTGGATCTCTGCAGTTCCAGG + Intergenic
1068060509 10:52063392-52063414 CTTTGGGGCTATGCAGTTCCTGG - Intronic
1068083679 10:52348256-52348278 CTTTGGGGCCCTGCAGTTTCTGG + Intergenic
1068102697 10:52575761-52575783 GAGTGGGGCACAGGAGTTCCTGG - Intergenic
1068130585 10:52890277-52890299 CTTTGGGGCTCAGCAGTTCCTGG + Intergenic
1068157595 10:53222151-53222173 CTTTGGGGCTTTGCAGTTCCTGG - Intergenic
1068226863 10:54117369-54117391 CCTTGGGGTTCTGCAGTTCCTGG - Intronic
1068283574 10:54908410-54908432 ATTTAGGGCTCTGCAGTTCCTGG - Intronic
1068300377 10:55131343-55131365 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
1068919376 10:62466200-62466222 CTTTGGGGTTCTGTAGTTCCTGG + Intronic
1069593052 10:69653660-69653682 CTTTGGGGCCCTGCGGTTCCTGG + Intergenic
1069778969 10:70943063-70943085 CAGGAGGGCTCTGCAGTTTGTGG + Intergenic
1069826303 10:71257109-71257131 CAGTGGGGCTGTGGGTTTCCAGG - Intronic
1070401300 10:76055826-76055848 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1071053011 10:81473882-81473904 CTTTGGGTCTCTGTAGTTCCTGG + Intergenic
1071060802 10:81569773-81569795 CTCTGGGTCCCTGCAGTTCCTGG - Intergenic
1071666517 10:87564020-87564042 CCCTGGGGCTCAGCAGCTCCAGG + Intergenic
1072303159 10:94081810-94081832 CAGTTGGACTCTGAAGTTACTGG - Intronic
1072896435 10:99371353-99371375 CAGTGGGGCTGTGTACTTTCAGG - Intronic
1073890533 10:108096337-108096359 CCCTGGGTCTCTGCAGTTCCTGG - Intergenic
1074247850 10:111713095-111713117 CTTTGGAGCCCTGCAGTTCCTGG - Intergenic
1074301714 10:112239722-112239744 CTTTGGGGCTCTGCAGTTCTTGG - Intergenic
1075125385 10:119695012-119695034 CTTTGGGGCTCTGCGGTTCCTGG - Intergenic
1075131993 10:119748303-119748325 CAGTGGGGCTCTGCAGTTCCTGG - Intronic
1077000763 11:321121-321143 CAGTGGGGTCCTGCAGCTGCTGG - Intronic
1077141686 11:1027590-1027612 CTCTGAGGCTCTGCAGTGCCCGG - Intronic
1077938939 11:6818965-6818987 CTTTGGGGCTCTGCAGCTCCTGG + Intergenic
1078345455 11:10544174-10544196 CTTGGGGGCTCTGCATTTCCTGG - Intergenic
1078874402 11:15378896-15378918 CTTTGGGGCTCTGTATTTCCTGG + Intergenic
1079472214 11:20789451-20789473 CTTTGGGGCCTTGCAGTTCCTGG - Intronic
1079503857 11:21132661-21132683 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1079674176 11:23203455-23203477 CTTTGGGGCTCTGGGGTTCCTGG + Intergenic
1080534409 11:33207653-33207675 CAAGGTGGCTCAGCAGTTCCTGG - Intergenic
1081010907 11:37811754-37811776 TTTGGGGGCTCTGCAGTTCCTGG - Intergenic
1081082170 11:38756176-38756198 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1081163841 11:39785228-39785250 CTTTGGGGCTGTGTAGTTCCTGG - Intergenic
1081767278 11:45620486-45620508 CTTAGGGGCTCTGTAGTTCCTGG - Intergenic
1083140642 11:60718477-60718499 ATTTGGGGCTCTGCAGTTGCTGG - Intergenic
1083660718 11:64250748-64250770 AGGAGGGGCTCTGCAGTGCCTGG - Intergenic
1083916190 11:65745075-65745097 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1083952748 11:65965901-65965923 CGGTGAGGCCCTGCAGGTCCCGG - Exonic
1084519698 11:69655761-69655783 CATTGCGGCTCTCCAGTTCCAGG + Intronic
1084568330 11:69944193-69944215 CAGTGGGAGTCTGCATTTCCAGG - Intergenic
1085212104 11:74790817-74790839 CTTTGGGGCTATGCAGTTCCTGG - Intronic
1085403839 11:76250120-76250142 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1086084670 11:82942722-82942744 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
1086508213 11:87528098-87528120 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1086850321 11:91800156-91800178 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1087131462 11:94672581-94672603 CTTTGGGGCTCTGCAGTCCCTGG + Intergenic
1087210964 11:95446305-95446327 CTCTGGGGCTTTGAAGTTCCTGG - Intergenic
1087453341 11:98352825-98352847 CTTTGGGGCTATGCAGTTCCTGG - Intergenic
1087534317 11:99424651-99424673 CTTTGGGGCTCTGCCATTCCTGG - Intronic
1088135748 11:106553281-106553303 CTTTGGGGCCCTGAAGTTCCTGG + Intergenic
1090116462 11:123979235-123979257 TCTTTGGGCTCTGCAGTTCCTGG - Intergenic
1090136928 11:124209044-124209066 CTTTGGGGCCCTGCAGTTCCTGG - Intergenic
1090194533 11:124803141-124803163 CTTTGGGACTCTGCAGTTCCTGG - Intergenic
1090613981 11:128497852-128497874 CAGAGAGGCTCTTCCGTTCCAGG + Intronic
1090910052 11:131110897-131110919 CCTTGGGGCTCTGCACTTCCCGG - Intergenic
1091656531 12:2350607-2350629 CATTCGGGCTCTTCAGTTCATGG - Intronic
1092138105 12:6163705-6163727 CAGTGGGGAGCTGCAGCTACAGG - Intergenic
1092205556 12:6612753-6612775 CAGTGCAGCTCTGCAGGCCCCGG + Intergenic
1092271940 12:7030608-7030630 CTTTGGGGCTCTACGGTTCCTGG - Intronic
1093182952 12:15988098-15988120 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1093281905 12:17204769-17204791 CTTTGGGGTCCTGCAGTTCCTGG + Intergenic
1093317134 12:17666169-17666191 CTTTGGGGCTCTGAAGTTTCTGG - Intergenic
1093764879 12:22952008-22952030 CTTTGGAGCTCTGCAGTTCCTGG - Intergenic
1094840042 12:34339028-34339050 CTGTGGGGCCCAGCAGCTCCGGG - Intergenic
1095603305 12:44038297-44038319 CTCTGGGGCTCTGCAGTTCCTGG + Intronic
1095749606 12:45696405-45696427 CTTTGGGGCTCTGCAGTTCCAGG - Intergenic
1095884076 12:47170435-47170457 CAGAGGGGCTCCTCACTTCCCGG + Intronic
1096295566 12:50381088-50381110 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1097078494 12:56412552-56412574 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1097130773 12:56809429-56809451 CTTTGGGGCCCTGCAGTTCCTGG - Intergenic
1097154013 12:56999666-56999688 CAGTGGGTCACTGGAGTGCCAGG + Exonic
1097298882 12:57997442-57997464 CTTTGGGGACCTGCAGTTCCTGG - Intergenic
1097360704 12:58655672-58655694 CTCTGGGGCTCTGCAGTTCCTGG - Intronic
1097473224 12:60021594-60021616 CACTTGGGGTCTGCAGTTTCAGG - Intergenic
1097500338 12:60393097-60393119 CTCTGGGGCTCTGCAGTTTCCGG + Intergenic
1097573224 12:61357512-61357534 CTTTCGGGCCCTGCAGTTCCTGG + Intergenic
1097684322 12:62677449-62677471 CTTTGGGGCTCTACAGTTCCTGG + Intronic
1098519563 12:71420505-71420527 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
1098802901 12:74984973-74984995 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1098951692 12:76645942-76645964 CTTTAGGGCTCTGCAGTTCCTGG + Intergenic
1099033825 12:77560660-77560682 CTTTGGGGTTCTGCGGTTCCTGG + Intergenic
1099049678 12:77767729-77767751 CTTTGGGGCTCTGCAGTTTCTGG - Intergenic
1099125885 12:78757483-78757505 CAGTTGAGCTCAGAAGTTCCAGG + Intergenic
1099285458 12:80709941-80709963 AAGTGTGGATCTGGAGTTCCCGG + Intergenic
1099295496 12:80823340-80823362 CTTTGGGGCTTTGCAGTTCCTGG + Intronic
1099321926 12:81161943-81161965 TTTTGGGGCTCTGCAGTTCCTGG - Intronic
1099682418 12:85844869-85844891 CTTTGGGGCCCTGCAGGTCCTGG + Intergenic
1099683247 12:85855671-85855693 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1099713839 12:86264954-86264976 CTTTGGGGCTCTGCGGTTCCTGG + Intronic
1099738656 12:86601926-86601948 CTTTGGGGCTCTGTGGTTCCTGG + Intronic
1101571341 12:105956698-105956720 CAGGGGCACTCTGCAGTCCCAGG + Intergenic
1103728795 12:123012586-123012608 CTGTGGGGCTCTGCCCTTCCTGG + Intronic
1104084076 12:125458493-125458515 CAGTGGGGCCTTGCAGGTCCTGG + Intronic
1104286691 12:127430749-127430771 GAGTGGGGCCTTGCAGGTCCTGG - Intergenic
1104729359 12:131096607-131096629 CCGTGGGGCACTGCTGGTCCAGG + Intronic
1104738141 12:131152607-131152629 CTTTGTGGCTCTGTAGTTCCTGG + Intergenic
1104742685 12:131189938-131189960 TTTTGGGGTTCTGCAGTTCCTGG + Intergenic
1105810068 13:23987301-23987323 CAGTGTGGCTCCTCATTTCCCGG - Intronic
1106253428 13:28001385-28001407 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1106268912 13:28135678-28135700 CATTTGGGCTCAGGAGTTCCAGG - Intergenic
1106614141 13:31310776-31310798 CCTTGGGGCTCCGCAGTTGCTGG + Intronic
1106999492 13:35526933-35526955 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1107229189 13:38087138-38087160 CTCTGGGGCTCTGTGGTTCCTGG + Intergenic
1107330473 13:39294855-39294877 CAGTTGAGCCCTGCAGTTCTGGG - Intergenic
1107841251 13:44459677-44459699 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
1108249690 13:48551755-48551777 CTTTGGGGTTCTGCAGTTTCTGG + Intergenic
1108542337 13:51455857-51455879 CTTTGGGGCTCTGCAGCTCCTGG - Intergenic
1108559273 13:51627170-51627192 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
1108915569 13:55606303-55606325 CCTTGGGGCTCCGCAGTTGCTGG + Intergenic
1108942708 13:55977501-55977523 CCTTGGGGCCCTGCAGTTACTGG + Intergenic
1109426316 13:62168939-62168961 CTTTGGGGCCTTGCAGTTCCTGG + Intergenic
1109603674 13:64663752-64663774 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1109837533 13:67878374-67878396 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1109851906 13:68076021-68076043 CTTTGGGGCTCACCAGTTCCTGG + Intergenic
1110014667 13:70386232-70386254 CTTTGGGACTCTGCAGTTCCTGG - Intergenic
1110201237 13:72852247-72852269 GTTTGGGGCTCTGCAGTTCCTGG + Intronic
1110730666 13:78876139-78876161 CTTTGGGGCTTTGCAGTTCCCGG - Intergenic
1110810756 13:79808500-79808522 CTTTGGGGCCCTGCATTTCCTGG + Intergenic
1110850689 13:80241413-80241435 CTTTGGGGCTCTGTAGCTCCTGG - Intergenic
1111002762 13:82206237-82206259 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1111119324 13:83824570-83824592 CTTTAGGGCTCTGCAGTTCCTGG + Intergenic
1111141578 13:84126901-84126923 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1111192852 13:84832266-84832288 CTTTCGGGCTCTGCGGTTCCTGG + Intergenic
1111268919 13:85854328-85854350 CTTTACGGCTCTGCAGTTCCTGG + Intergenic
1111304077 13:86383109-86383131 CTTTGGGGCTTTGCAATTCCTGG + Intergenic
1111337074 13:86838755-86838777 CTTTGGGGTTCTGCAGTTTCTGG - Intergenic
1111474421 13:88726105-88726127 CTTTGGGGCTCTGCAGTTCTTGG + Intergenic
1111485788 13:88896495-88896517 CCTTGGGGCTCTGTGGTTCCTGG + Intergenic
1111487714 13:88926370-88926392 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1111549023 13:89783576-89783598 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1111842864 13:93472589-93472611 CTTTGGGGCCCTGCAGTTCCTGG - Intronic
1113503181 13:110794136-110794158 CTTTGGGGCTCTGGGGTTCCTGG + Intergenic
1113719840 13:112546863-112546885 CAATGGGGCCCTGCAGATTCTGG + Intronic
1113970794 13:114186626-114186648 CTTTGGGGCCCTGCAGTTCCTGG + Intergenic
1114344611 14:21781649-21781671 GTTTGGGGCTCTGCAGTTCCAGG + Intergenic
1115059187 14:29169368-29169390 CTTTGAGGCTCTGCAGTTTCTGG + Intergenic
1115485093 14:33902375-33902397 CTCTGGGACTCTGCAGTTCCTGG + Intergenic
1116151189 14:41144792-41144814 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1116159666 14:41253084-41253106 CTTTGGGGTTCTGCGGTTCCTGG - Intergenic
1116448429 14:45038600-45038622 CTTTGGGGTTCTGCAGTTGCTGG - Intronic
1116961748 14:50974004-50974026 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1117734109 14:58751841-58751863 CTTTGGGGCTCTGCGGTTCCTGG + Intergenic
1118703897 14:68462062-68462084 CAGTGGGACTCAGCAGATCTGGG - Intronic
1118865916 14:69703443-69703465 CAGGGGGTCTCTGCAGGGCCGGG - Exonic
1118922327 14:70160733-70160755 CAGGAGGGCTCTGGACTTCCTGG + Intronic
1119036291 14:71232530-71232552 CTTTGGGGCTCTGAGGTTCCTGG + Intergenic
1119257072 14:73208080-73208102 CTTTGGGGTTCTGCAGTTCCTGG - Intronic
1119808485 14:77498170-77498192 CAGTGGGGCTCTCCAGCCGCCGG - Intronic
1120590129 14:86364726-86364748 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1120766961 14:88336915-88336937 CAGTGGGGCTGGGCAGTTGTGGG + Intergenic
1121368745 14:93337807-93337829 CTTTGGGGCTCTGTGGTTCCTGG + Intronic
1122418278 14:101560664-101560686 CAGCGGGGCGCCGCGGTTCCTGG - Intergenic
1122491344 14:102117866-102117888 CTTTGGGGCCCTGCAGTTCCTGG + Intronic
1122829949 14:104390996-104391018 TTGTGGGGCTCTGCAGCTCTTGG + Intergenic
1124820966 15:33045075-33045097 CTTTGGGGCTCTGCAGTTTCTGG + Intronic
1125113969 15:36067209-36067231 CTTTGGGGCTCTGCAGTTAATGG - Intergenic
1125718255 15:41831997-41832019 CTTTAGGGCTCTGCGGTTCCTGG + Intronic
1125767743 15:42146425-42146447 CAGTGGGTCTGTACAATTCCAGG + Intronic
1126215297 15:46146951-46146973 CTCTGGGGCTCTGTGGTTCCTGG + Intergenic
1128965393 15:72052621-72052643 CTTTGGGGCTCTACGGTTCCTGG + Intronic
1129458628 15:75688934-75688956 CACTGGGGCCCTGCAGTTTGGGG - Exonic
1129591171 15:76916315-76916337 CTTTGGGGTTCTGCCGTTCCTGG + Intergenic
1129919873 15:79311115-79311137 CAGCGGAGCTCTGCGCTTCCGGG - Exonic
1130183282 15:81652410-81652432 CTTTGGGGCCTTGCAGTTCCTGG + Intergenic
1131705662 15:94992980-94993002 CAGTGGGGCTTGCCATTTCCTGG + Intergenic
1131999146 15:98162417-98162439 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1132898967 16:2243224-2243246 GAGTGGGTGTCTGCATTTCCAGG - Exonic
1133169793 16:3975094-3975116 CACTGTGGCTCTCCAGCTCCAGG + Intronic
1133697996 16:8283195-8283217 CTGTGAGGCTCTGCATTTCAAGG - Intergenic
1135435447 16:22424159-22424181 CACTGTGGCTGTGCAGTTCAAGG - Intronic
1138925040 16:61580943-61580965 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1139015561 16:62684812-62684834 CTTTGGGGCTCTGCAGTTCCAGG + Intergenic
1139625733 16:68187258-68187280 CTTTGGGGCTCTGAGGTTCCTGG - Intronic
1141436355 16:84001931-84001953 CAGGTGGCCACTGCAGTTCCAGG - Intronic
1142347823 16:89565351-89565373 TAGTGCGGCTCTGCCCTTCCTGG + Exonic
1142370039 16:89674243-89674265 CCTTGGGGCTCTGCCGTTCCTGG - Intergenic
1143530376 17:7499527-7499549 CAGTGGGGCTCTGGGGTGCAAGG + Intronic
1144060852 17:11582497-11582519 CTTTGGGGCCCTGCAGTGCCTGG - Intergenic
1144812817 17:18011624-18011646 CAGGGTGGCACTGCAGCTCCTGG - Intronic
1145065993 17:19761855-19761877 CCGTGGGCCTCTGCAGCTGCAGG + Intergenic
1146425395 17:32732879-32732901 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
1147252937 17:39164680-39164702 CACTGAGGCTCTGTAGCTCCTGG - Intronic
1148386197 17:47236903-47236925 CTTTGGGGCCCTGCAGTTCCTGG - Intergenic
1149169588 17:53792966-53792988 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1149256780 17:54836391-54836413 CTTTGGGGCTCTGTAGTTCCTGG - Intergenic
1149329585 17:55567447-55567469 CTGTTTGGCTCTGCACTTCCAGG - Intergenic
1149329947 17:55570376-55570398 CTTTGGGGCCCTGCAGTTCCTGG + Intergenic
1150951067 17:69802490-69802512 CTCTGGGGCCCTGCAGTTCCTGG + Intergenic
1151342245 17:73479229-73479251 CAGTGGCCCACTGCTGTTCCTGG - Intronic
1151665721 17:75544169-75544191 CAGTGTGGCTCTTCAGCTCCCGG + Intronic
1152124300 17:78437233-78437255 CAGTGGGGCTCTGTACTCCCAGG + Intronic
1152210097 17:78998584-78998606 CAGTGAAGGGCTGCAGTTCCTGG - Intronic
1152530556 17:80916263-80916285 CTCTGGGGCTCTGCAGTTCCTGG + Intronic
1153427888 18:4987024-4987046 TTTTGGGGCTCTGCGGTTCCTGG - Intergenic
1153608267 18:6855737-6855759 CTTTGGAGCTCTGCAGTTCCGGG + Intronic
1153724068 18:7937299-7937321 CTTCGTGGCTCTGCAGTTCCTGG + Intronic
1154357412 18:13632550-13632572 CTTTGGGACTCTGCAGTTCCTGG - Intronic
1155215857 18:23642316-23642338 CTTTGGGGCTCTGCGGTTCCTGG + Intronic
1155819269 18:30353464-30353486 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1156244344 18:35283706-35283728 CGTTGGGGCCCTGCATTTCCTGG - Intronic
1157042811 18:44060550-44060572 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1157506759 18:48231819-48231841 CTTTAGGGCTCTGCGGTTCCAGG + Intronic
1159292504 18:66440386-66440408 CTTTGGGGCTCTGTGGTTCCCGG + Intergenic
1159458638 18:68694285-68694307 CTTCAGGGCTCTGCAGTTCCTGG + Intronic
1159519005 18:69495185-69495207 CTTTGGGGCTTTGCATTTCCTGG - Intronic
1159775322 18:72597993-72598015 CAGCTGGGATCTGCAATTCCCGG - Intronic
1159930870 18:74311883-74311905 CTTTGGGGCCCTGCAGTTCCTGG - Intergenic
1159989809 18:74891289-74891311 CAGTGGAGATCTTCAGCTCCAGG - Intronic
1159999595 18:75004106-75004128 CAGTGTGGCCCTGGAGTGCCTGG + Intronic
1160008917 18:75089037-75089059 CAGGCGGCCTCTCCAGTTCCAGG - Intergenic
1160083488 18:75753250-75753272 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1160494753 18:79366332-79366354 CAGTGTGGTTCTGCGGTTCATGG - Intronic
1160857738 19:1224911-1224933 CAAGGGGGCTCTGCAGGTCAGGG - Intronic
1161652259 19:5492602-5492624 CCGTGGGGCTCAGCAGTCCAGGG - Intergenic
1162459192 19:10804095-10804117 CAGGAGGGCCCTGCAGGTCCAGG + Intronic
1163021121 19:14481325-14481347 CACTGGAGCTCAGGAGTTCCAGG - Intronic
1163159519 19:15456577-15456599 CCGTGAGGCGCTGCTGTTCCGGG - Exonic
1163272652 19:16263445-16263467 CAGTGAGGCTCTGAAGGTGCTGG + Intergenic
1163519614 19:17784178-17784200 CAGTGGGGTTCTGCTCTGCCTGG - Exonic
1164273737 19:23698808-23698830 CAGTGGAGCTCTACAGCTCCAGG + Intergenic
1164615014 19:29662598-29662620 CAGTGGGGCTCGGCATTTTCAGG - Intergenic
1164984515 19:32638629-32638651 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
925142113 2:1557754-1557776 CAGAGGGGCTCTGCCGACCCCGG + Intergenic
925396057 2:3534496-3534518 CCTTGGGGCTCTGCGGTTCCTGG + Intronic
925515411 2:4675346-4675368 CTTTGGGTTTCTGCAGTTCCTGG + Intergenic
926541345 2:14183779-14183801 CCTTGAGGCCCTGCAGTTCCTGG + Intergenic
926554644 2:14342344-14342366 CTTTGGGGTTCTGCAGTTCCTGG + Intergenic
927084353 2:19659703-19659725 CAGTGGGGTGGGGCAGTTCCTGG + Intergenic
927236387 2:20879575-20879597 CTTTGGGGCTCTGCAATTCCTGG - Intergenic
927533762 2:23836351-23836373 CTTTGGAGCCCTGCAGTTCCTGG - Intronic
927613484 2:24565923-24565945 CTTTGGAGCTCTGCAGTTCCTGG - Intronic
927671458 2:25072098-25072120 CAGTGTGGCTATGAAGCTCCGGG + Intronic
927743082 2:25590119-25590141 CCTTGGGGCTCTGTGGTTCCTGG - Intronic
927873678 2:26640342-26640364 CAGTGGGGCTCTGCGGATCGTGG + Intronic
929492553 2:42408895-42408917 CTTTGGGGCCCTGCTGTTCCTGG + Intronic
930729102 2:54710210-54710232 CTTTAGGGCTCTGCAGTTTCTGG + Intergenic
931743151 2:65266963-65266985 CAGTGGGGCTATGGAGTTTTAGG + Intronic
931976171 2:67646568-67646590 CCTTGGGGCTCTGCAGTTGCTGG - Intergenic
932398170 2:71462378-71462400 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
933042677 2:77488172-77488194 CTTTGGGGCTCTTCAGTACCTGG + Intronic
933455001 2:82508670-82508692 CTTTGGGGCTCTGCAGTTTCTGG + Intergenic
935667702 2:105526429-105526451 CTTCGGGGCTCTGCAGTTCCTGG + Intergenic
936947298 2:117942101-117942123 AACTGGGTCTCTGCAGCTCCAGG + Intronic
937955908 2:127421720-127421742 CAGTGGTGCTCAGCAGTGGCTGG - Intronic
937966357 2:127514572-127514594 CCTTGGGGCTCTGCAGTTCCTGG + Intronic
938187211 2:129242537-129242559 CAGTGGGGCTCAGGGGTTCGGGG + Intergenic
938722015 2:134075691-134075713 TTTTGAGGCTCTGCAGTTCCTGG - Intergenic
940129955 2:150369912-150369934 CCTTGGGGCTCTGCAGTTCCTGG + Intergenic
940299259 2:152160771-152160793 CAGAGGGGCTCCTCACTTCCCGG - Intronic
940396195 2:153195574-153195596 CTTTGGGGCCCTGCAGTTCCCGG - Intergenic
940711109 2:157164714-157164736 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
941131154 2:161651568-161651590 CTTTGGGGCTCTGCGGTTTCTGG + Intronic
941151492 2:161919894-161919916 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
942053381 2:172161807-172161829 TTTTGGGGCCCTGCAGTTCCTGG - Intergenic
942114256 2:172712660-172712682 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
942315472 2:174693130-174693152 CTTTGGGGCTCAGCAGGTCCTGG + Intergenic
942319339 2:174722913-174722935 CAGTGGGGCCCAGCCGTACCTGG + Intergenic
942584947 2:177465732-177465754 CTTTGGGGCTCTGCAGTCCCTGG - Intronic
942683200 2:178501226-178501248 CTGTGGGGCTCTGTAATTTCTGG + Intronic
943049091 2:182894153-182894175 CACTGGGGCTCTGTGGTTGCTGG + Intergenic
943191131 2:184680877-184680899 CTTTGGGGCTCTGCAGTTGCTGG + Intronic
943191610 2:184685291-184685313 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
943224064 2:185145470-185145492 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
943426619 2:187745746-187745768 CTTTGGGGCTCTGCAGTTTCTGG - Intergenic
943426909 2:187749358-187749380 CTTTGGGGCTGTGCAGTTTCTGG - Intergenic
943858508 2:192828946-192828968 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
943928406 2:193819112-193819134 CTTTGGGGCTCTGGAGTTCCTGG - Intergenic
944022599 2:195125068-195125090 CTTTGGGTCTCTGCAGTTCCTGG - Intergenic
944146844 2:196515035-196515057 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
944531702 2:200673932-200673954 CAGTACTGCTCTGCAGTTACAGG + Intronic
945394919 2:209306111-209306133 CTTTGGGGGTCTGCGGTTCCTGG - Intergenic
945770318 2:214034738-214034760 CTATGGGGCTTTGCAGTTCCTGG - Intronic
947845389 2:233239648-233239670 CAGTCGGGCTCTGTAGATGCTGG + Intronic
948334833 2:237199940-237199962 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
948627028 2:239275695-239275717 CTGGGGGCCTCTGCAGTGCCTGG + Intronic
948713281 2:239839291-239839313 TTTTAGGGCTCTGCAGTTCCTGG + Intergenic
948782019 2:240327677-240327699 CTTTAGGACTCTGCAGTTCCTGG + Intergenic
1169140150 20:3223227-3223249 GAGTGGGGCCCAGCAGCTCCTGG - Intronic
1169309427 20:4522277-4522299 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1170043760 20:12064849-12064871 CTTTGGGGCCCTGCAGTCCCTGG - Intergenic
1170327940 20:15176871-15176893 CTTTGGGGCTCTGTGGTTCCTGG + Intronic
1171273514 20:23835066-23835088 TGGTGGGAGTCTGCAGTTCCTGG - Intergenic
1172269853 20:33648559-33648581 CTGGGGGGCCCTGCAGCTCCAGG + Exonic
1172722953 20:37013037-37013059 CAGAGGGGCTCCTCACTTCCCGG - Intronic
1173100171 20:40080200-40080222 CTGTGTGGCTCTGCAATTTCAGG + Intergenic
1173416941 20:42865308-42865330 CAGTGGGTCTCAGGAGATCCGGG - Intronic
1173740235 20:45395049-45395071 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
1174718854 20:52789317-52789339 CTCTGGGGATCTGCAGTCCCAGG - Intergenic
1175549694 20:59809076-59809098 CAGTGGGGCTTTTCATTTCGAGG + Intronic
1175553642 20:59832649-59832671 CAGTGCCGCTCTGGGGTTCCAGG + Intronic
1175959830 20:62630370-62630392 CTTTAGGGCTCTGCAGTTCCTGG - Intergenic
1176104691 20:63380455-63380477 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1176976596 21:15327847-15327869 CTTTGGGGCTTTGTAGTTCCGGG + Intergenic
1176993032 21:15521602-15521624 CTTTGGGGCTCTGTAGTTCCTGG - Intergenic
1177112831 21:17049327-17049349 CCTTGGGGTTCTGCAGTTGCTGG - Intergenic
1177826494 21:26090045-26090067 CATTGGTGATCTGCAGTTCAGGG + Exonic
1177875306 21:26625358-26625380 CTTTGGAGCTCTGCAGTTCTTGG - Intergenic
1178937515 21:36875903-36875925 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
1179131293 21:38639557-38639579 CAGTGGGCCTCTTCAGTTGTGGG - Intronic
1179138037 21:38697834-38697856 CAGTGAGGCTCTGGAGTAGCTGG - Intergenic
1179170038 21:38965897-38965919 CAGGTGGGCCCTGCAGTCCCTGG - Intergenic
1179407448 21:41137347-41137369 CTTTGGGGATCTGCAGTTCCTGG + Intergenic
1179719274 21:43306225-43306247 GAGTGGGGACCTGCAGTGCCCGG + Intergenic
1180025948 21:45162191-45162213 CTTTGGGGCCCTGCGGTTCCTGG + Intronic
1180174778 21:46082259-46082281 CACTGTGGCTTTGCAGTCCCTGG + Intergenic
1181280766 22:21718584-21718606 CAGAGGAGCTCTGCAGCGCCTGG + Intronic
1183024880 22:35057624-35057646 CTTTGGGGCTCTGAGGTTCCTGG - Intergenic
1183291890 22:37007788-37007810 CAGTGGGGATCTGCACTTCTGGG - Exonic
1183299989 22:37054178-37054200 CTGTGGGGCTCTGCAGGGCCAGG - Intronic
1183417446 22:37690761-37690783 CAGGGGGTCTCTGGACTTCCTGG - Exonic
1184115506 22:42419585-42419607 GAGCGGGGCTGTGCAGGTCCTGG - Intronic
1184869339 22:47225396-47225418 CTTTGGGGCCCTGCGGTTCCTGG - Intergenic
1184876813 22:47281512-47281534 CTGAGGGGGTCTGCAGGTCCAGG - Intergenic
949226456 3:1700633-1700655 CTCTGGGGCTCTGTGGTTCCTGG + Intergenic
950261201 3:11544359-11544381 CTGTGGGGCTCTGCAGATGGGGG - Intronic
950654973 3:14430953-14430975 CAGTGGGGCTTTGGAGGTCTTGG - Intronic
951509574 3:23486346-23486368 CTATGGGGCTCTGAAGTTCCTGG - Intronic
952456614 3:33478539-33478561 CACTGGGGCACAGCAGTTCAAGG + Intergenic
952657269 3:35801524-35801546 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
952893969 3:38064554-38064576 CAGAGGGGCTCCTCACTTCCCGG + Intronic
952970079 3:38645253-38645275 CTGTGGGGCTCTCCCGTCCCAGG + Intronic
953180642 3:40591224-40591246 CAGTGGATCTCAGCAGTTCCAGG + Intergenic
953432715 3:42852953-42852975 CAGTGTGGCCCTGGATTTCCTGG + Intronic
953748085 3:45590534-45590556 CTTTGGGGCTCTGCGGTTCCTGG - Intronic
955213760 3:56966322-56966344 CAGTTGGGCTGTGCCCTTCCAGG - Intronic
957417983 3:79930142-79930164 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
957614591 3:82510140-82510162 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
957618708 3:82567242-82567264 CCTTGGGACTCTGCAGTTGCTGG + Intergenic
957665086 3:83217284-83217306 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
957788060 3:84906036-84906058 CTTTGGGGCTCTGTGGTTCCCGG + Intergenic
957923162 3:86772784-86772806 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
958019572 3:87979943-87979965 CTTCGGGGCTCTGCAGTTCCTGG - Intergenic
958141681 3:89570800-89570822 CTTTGGGGCTCTGCAGTTTCTGG - Intergenic
958498306 3:94874212-94874234 GTTTGGGTCTCTGCAGTTCCTGG - Intergenic
958677998 3:97292201-97292223 CTTTGGGGCTCTGCGGTTCCTGG - Intronic
959037560 3:101384440-101384462 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
959460795 3:106623212-106623234 CCTTGTGGCTCTGCAGTTCTGGG + Intergenic
959897187 3:111617910-111617932 CTTTGGAGCTCTACAGTTCCTGG + Intronic
960011044 3:112834930-112834952 TTTTAGGGCTCTGCAGTTCCTGG - Intronic
961311484 3:126004650-126004672 CTTTGGGGCTCTGCGGTACCTGG + Intergenic
961661195 3:128469631-128469653 CCACGGGGCTCTGCAGTTTCCGG + Intergenic
961942882 3:130656056-130656078 CTCTGGGGGTCTGCAGTTCCTGG - Intronic
962211915 3:133486629-133486651 ATTTGGGGCTCTGCAGTTACTGG - Intergenic
962824444 3:139087858-139087880 CTTTGAGGCCCTGCAGTTCCTGG - Intronic
963250292 3:143096362-143096384 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
963301479 3:143601963-143601985 CAGACTTGCTCTGCAGTTCCTGG + Intronic
964075091 3:152683925-152683947 CTTTGGGGCTCTGCAATTCCTGG - Intergenic
964590613 3:158359622-158359644 CCTTGGGACCCTGCAGTTCCTGG - Intronic
964927738 3:161978190-161978212 CTTGGAGGCTCTGCAGTTCCTGG - Intergenic
964996875 3:162892378-162892400 CTTTGGGGCCCTGCAGTTCCTGG + Intergenic
965115125 3:164478320-164478342 CTTTAGGGCTCTGCAGTTTCTGG + Intergenic
965118525 3:164521520-164521542 CTTTGGGGCTTTGCAGTTCCTGG - Intergenic
965773873 3:172208995-172209017 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
965813291 3:172613622-172613644 CTTTGGGGCCCTGCAGTTCCTGG - Intergenic
965924201 3:173958063-173958085 GTTTGGGGCTCTGCAGTTCTTGG - Intronic
965984565 3:174736122-174736144 CTCTGGGGCTCTGAGGTTCCTGG - Intronic
966840240 3:184082082-184082104 CTTTGAGGCCCTGCAGTTCCTGG + Intergenic
966863010 3:184241161-184241183 CAGTGGGGATCATCAGTGCCAGG - Intronic
968980696 4:3847920-3847942 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
969109861 4:4837585-4837607 CAGAGGGCCTCTGAGGTTCCTGG + Intergenic
969179322 4:5424908-5424930 CTTTGGGGCTCTGCATTTCCTGG + Intronic
969327018 4:6449965-6449987 AAATGGGGCTCGGCAGCTCCCGG - Intronic
970174412 4:13324337-13324359 CAGTGGGGCTCTGAAGGGACTGG - Intergenic
970933993 4:21546816-21546838 GAATGGGGCTCTGCAGATCTGGG + Intronic
970959755 4:21857897-21857919 CTTTGGGGTTCTGCAGTTTCTGG + Intronic
971019109 4:22516216-22516238 GAGTCGGGCTCGGCAGGTCCCGG - Intergenic
971092505 4:23361424-23361446 CACTTGGGCTCTGCAGTTCCTGG + Intergenic
971876753 4:32318353-32318375 TTCTGGGGCTGTGCAGTTCCTGG - Intergenic
972645922 4:40967446-40967468 CTTTGGGGCTCTGTGGTTCCTGG + Intronic
972679067 4:41288210-41288232 CTTGGGGGCTCTGCAGTTGCTGG - Intergenic
974420233 4:61663285-61663307 CTTTGGAGCTCTGCAGTTCCTGG + Intronic
974521520 4:62987132-62987154 CCTTGGGGTTCTGCAGTTGCTGG - Intergenic
974607771 4:64174529-64174551 CCTTGGGGCTCTGCGGTTCCTGG + Intergenic
974615338 4:64272438-64272460 CCTTGGGGTTCTGCAGTTGCTGG + Intergenic
974686732 4:65241539-65241561 CTTTGGGGCTCCGCAGTTTCTGG - Intergenic
974698012 4:65399114-65399136 CTTTGGGGCTTTGCAGTTTCTGG + Intronic
974894950 4:67927311-67927333 CTTTGGGACCCTGCAGTTCCTGG + Intronic
975254263 4:72215589-72215611 CTTTAGGGCTCTGCAGTTCCTGG - Intergenic
975498403 4:75058484-75058506 CTTTGAGGCCCTGCAGTTCCTGG + Intergenic
976129769 4:81871562-81871584 CTTTGGAGCTCTGCAGTTCCTGG + Intronic
976178874 4:82380792-82380814 CTTTGGGGTTCTGCGGTTCCTGG - Intergenic
977410375 4:96654084-96654106 CTTTGGGGCTCTGCCATTCCTGG + Intergenic
977487250 4:97665094-97665116 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
977816155 4:101416324-101416346 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
977948054 4:102936884-102936906 CAGGGGTTCTCTGCATTTCCTGG - Intronic
978149264 4:105414612-105414634 CTTTGGGGCTCTGCACTTCTTGG - Intronic
978219627 4:106255584-106255606 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
978229810 4:106385237-106385259 CTTTGGGACCCTGCAGTTCCTGG - Intergenic
978248479 4:106603756-106603778 CTATGGGGCTCTGCAGTTCCTGG - Intergenic
978347553 4:107788048-107788070 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
978605736 4:110476846-110476868 CAGAGGGCCTCTTCAGCTCCGGG - Exonic
978822190 4:112979387-112979409 CTTTGGGGCTCCGCAGTCCCTGG - Intronic
979010868 4:115366390-115366412 CTTTGGGGTACTGCAGTTCCTGG + Intergenic
979253810 4:118591791-118591813 CACTGGGGCGCTACGGTTCCTGG + Intergenic
979448128 4:120839082-120839104 CTTTGGGGTGCTGCAGTTCCTGG - Intronic
979856455 4:125639099-125639121 CCTTGGGACTCTGCAGTTGCTGG + Intergenic
979956233 4:126956446-126956468 CTTTGGGGCTCTGCCGTTCCTGG + Intergenic
980007688 4:127559998-127560020 CTTTGGGGCCCTGCAGTTTCTGG + Intergenic
980243278 4:130203595-130203617 CTTTAGGGCCCTGCAGTTCCTGG + Intergenic
980282392 4:130737864-130737886 CTTTGGGTCTCTGCAGTTTCTGG + Intergenic
980308643 4:131099362-131099384 CTTTGGGGCTCTGCAGCTCCTGG - Intergenic
980469684 4:133234582-133234604 CAGTTGTGTTCTGCAGTTCAAGG - Intergenic
980574292 4:134665753-134665775 TTTGGGGGCTCTGCAGTTCCTGG - Intergenic
980729727 4:136810990-136811012 CTTTGGGGCCCTGCAGTTCCTGG - Intergenic
981727254 4:147861338-147861360 CTTTGGGGCTCTGCGGTTCCTGG - Intronic
982157945 4:152539907-152539929 CTTTGGGTCCCTGCAGTTCCTGG - Intergenic
982181554 4:152752364-152752386 CTTTGGGGTTTTGCAGTTCCTGG + Intronic
982403860 4:154998934-154998956 CTGTGGGTCTCTGCAGTTTTTGG + Intergenic
983323870 4:166228096-166228118 CTTTGGGGCTCTGCAGTTCTTGG + Intergenic
983492010 4:168399320-168399342 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
984169353 4:176342763-176342785 CATTGGGGGTCTGCAGTTCCTGG - Intergenic
984375422 4:178922872-178922894 TCTTTGGGCTCTGCAGTTCCTGG + Intergenic
984526605 4:180866127-180866149 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
984763908 4:183384965-183384987 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
985777438 5:1852178-1852200 CCGGGGAGCTCTGCATTTCCTGG + Intergenic
986011652 5:3722487-3722509 CAGTGTGGCTTTGCAGTGGCTGG + Intergenic
986896979 5:12383208-12383230 CAGGGGTTCTCTGCATTTCCTGG + Intergenic
986923609 5:12717970-12717992 CTTTGGGGCTTGGCAGTTCCTGG + Intergenic
987815908 5:22901193-22901215 CTTTGGGGCTCTGGGGTTCCTGG - Intergenic
988110031 5:26807839-26807861 CTTTGGGGATCTGCGGTTCCTGG + Intergenic
990878863 5:60517995-60518017 CTTTGGGGCTCTGTAGTTCCTGG + Intronic
991039581 5:62162005-62162027 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
991230959 5:64331852-64331874 CCTTGGGGTTCTGCAGTTCCTGG + Intronic
992029589 5:72708475-72708497 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
992838832 5:80667762-80667784 CTCTGGGGCTCTGCAGTTCCTGG - Intronic
993617929 5:90136295-90136317 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
993703264 5:91143184-91143206 CTTTGGGGCTCTGCAGGTCCTGG - Intronic
994239588 5:97405972-97405994 TTTGGGGGCTCTGCAGTTCCTGG - Intergenic
994360489 5:98844355-98844377 CAGTGGGCCTATGGAGTCCCAGG + Intergenic
994406471 5:99352053-99352075 CTTTGGAGTTCTGCAGTTCCTGG - Intergenic
994451652 5:99951192-99951214 CTTTGCAGCTCTGCAGTTCCTGG + Intergenic
994518053 5:100794788-100794810 CTTTGGGGCTCTGCATTTCCTGG + Intergenic
994692278 5:103034024-103034046 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
994753133 5:103763731-103763753 CTATGGGGCTCTGTGGTTCCTGG - Intergenic
994891402 5:105640352-105640374 CTTTTGGGCTCTGTAGTTCCTGG + Intergenic
994948208 5:106423504-106423526 CTTTGGGACTCTGCAGTTCCTGG + Intergenic
995386717 5:111596707-111596729 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
995395195 5:111679888-111679910 CCTTGGGGCTCTGCGGTTGCTGG - Intronic
995724091 5:115166775-115166797 CTTTGTGGCTCTGCAGTTGCCGG + Intronic
995927098 5:117387026-117387048 CTTTGGGACTCTGCGGTTCCTGG + Intergenic
996217412 5:120886856-120886878 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
996306326 5:122052253-122052275 CAGAGGTTCTCTGCATTTCCTGG + Intronic
997042709 5:130277340-130277362 CTTTGGGACTCTGCAGTTCCTGG - Intergenic
997387186 5:133482819-133482841 CAGGGAAGCTCTGCATTTCCTGG + Intronic
997579543 5:135008652-135008674 CAGGGGTGCTCTGCATTCCCAGG + Intronic
997845544 5:137282857-137282879 AAGTGGGGCTCTGAAATCCCAGG + Intronic
997874706 5:137537667-137537689 CAGAGGGGCTCCTCACTTCCCGG + Intronic
998754094 5:145357244-145357266 CAGAGGTTCTCTGCATTTCCTGG + Intergenic
999287125 5:150400806-150400828 AAGTGGGCTTCTGCATTTCCAGG - Intergenic
1000233132 5:159333920-159333942 CTAAGGAGCTCTGCAGTTCCAGG + Intergenic
1000266361 5:159641661-159641683 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1000472337 5:161660827-161660849 CTTTGGGGCTCTGCAATTCCTGG + Intronic
1000979192 5:167798522-167798544 AAGAGGGGCTGTGCAGTTCGAGG + Intronic
1001605526 5:172957430-172957452 CAGTGAGGCTCTGAACTTCTTGG + Intergenic
1001997131 5:176171379-176171401 CTGTAGGGCTCTACGGTTCCTGG - Intergenic
1003666884 6:8119535-8119557 GTGTGGGGTTCTGCAGTTGCAGG + Intergenic
1003962174 6:11219054-11219076 CACTTGGGTTCTGCTGTTCCTGG + Intronic
1006463737 6:34178703-34178725 TTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1007229687 6:40339679-40339701 CAACGGGGCTCTGCTGTGCCTGG - Intergenic
1007403138 6:41616344-41616366 CAGAGGGGCTCCTCACTTCCCGG - Intergenic
1007570920 6:42890474-42890496 CAGTGGGCCCCTGAGGTTCCAGG - Exonic
1009243283 6:61204436-61204458 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1009306875 6:62102424-62102446 CTTTGGGGCTCTGCAATCCCTGG - Intronic
1009534232 6:64860566-64860588 CTTTGGGGCTCTGCAGGTCCTGG - Intronic
1009582700 6:65557524-65557546 CTTTGGGGCTCCGCAGTTCCTGG - Intronic
1009588717 6:65638508-65638530 CTTTGGGGCTCTGTGGTTCCTGG + Intronic
1009643015 6:66362273-66362295 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1009846814 6:69145401-69145423 TTTGGGGGCTCTGCAGTTCCTGG - Intronic
1009870770 6:69450233-69450255 CTTTCGGGTTCTGCAGTTCCTGG - Intergenic
1010127523 6:72450467-72450489 CAGTGGGGTTCTGGAGTTTTTGG - Intergenic
1010341223 6:74755242-74755264 ATTTGGGGCCCTGCAGTTCCTGG + Intergenic
1010519787 6:76818501-76818523 CTTTGGGGCTCTGCGGTTCCTGG + Intergenic
1010590316 6:77704618-77704640 AAGTGGGGCTCAGCAGTTTGTGG + Intronic
1010846979 6:80720780-80720802 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1011795637 6:90948503-90948525 CTTTGAGGCCCTGCAGTTCCTGG + Intergenic
1011822541 6:91270910-91270932 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1012100962 6:95084831-95084853 CTTAGGTGCTCTGCAGTTCCTGG + Intergenic
1012231091 6:96762124-96762146 CTTTGGGGCCCTGCAGTTCCTGG - Intergenic
1012752853 6:103184793-103184815 CTTTGGGGCTATGCAGTTCCTGG + Intergenic
1013438508 6:110138284-110138306 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
1014227076 6:118861259-118861281 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
1014391791 6:120873185-120873207 CTGTGGGGCTCTGTGGCTCCTGG + Intergenic
1014418662 6:121214619-121214641 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1014662727 6:124193494-124193516 CCTTAGGGCTCTGCGGTTCCTGG - Intronic
1015143405 6:129959490-129959512 CTTTAGGGCTCTGCGGTTCCTGG + Intergenic
1015662728 6:135593747-135593769 CACTTGGGCTCTGGAGTTCAAGG + Intergenic
1016076667 6:139804546-139804568 CTTTGGGGCTCTGCAGTTTCTGG - Intergenic
1016210917 6:141532175-141532197 CTTTGGGACTCTACAGTTCCTGG + Intergenic
1016237948 6:141890756-141890778 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1016402409 6:143694732-143694754 CAATGGGGCTCTGCGTTTTCTGG - Intronic
1016758769 6:147715467-147715489 CTCTGGGGCTCTGTGGTTCCTGG - Intronic
1017522253 6:155212990-155213012 CTTTGGGGCTCAGCGGTTCCTGG - Intronic
1018388192 6:163323285-163323307 CAGGTGGGCCCTGCATTTCCGGG - Intergenic
1018783809 6:167092720-167092742 CCGGTGGGGTCTGCAGTTCCTGG - Intergenic
1019340240 7:505468-505490 CAGGGGGTCTCTGCAGCTTCTGG - Intronic
1019987267 7:4666830-4666852 CAGTGGAGCCCTGGAGTTCAAGG - Intergenic
1020586879 7:10079632-10079654 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1020649350 7:10855596-10855618 CTGTAGGGCACTGCGGTTCCTGG + Intergenic
1020746950 7:12090752-12090774 CATTGGTGCTGTGCACTTCCAGG - Intergenic
1020832470 7:13109584-13109606 CTTTGGGAATCTGCAGTTCCTGG - Intergenic
1021021041 7:15599340-15599362 TTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1021689018 7:23214316-23214338 CAGGGGGCCTCTCCTGTTCCTGG + Intergenic
1022391982 7:29951115-29951137 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
1022763208 7:33380270-33380292 TAGTGGGGCTCAGCAGGTGCAGG - Intronic
1023114601 7:36849885-36849907 CAGTGGGACTTTGCATTTGCTGG + Intergenic
1024024724 7:45400593-45400615 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1024068881 7:45769137-45769159 CACTGGGGCGCTACAGTACCTGG + Intergenic
1024460872 7:49658126-49658148 CACTGGAGCTCAGGAGTTCCAGG + Intergenic
1026163639 7:67890846-67890868 CAGAGGCGCTCTTCACTTCCAGG - Intergenic
1026391944 7:69911305-69911327 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1026393517 7:69927867-69927889 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1027734824 7:81919903-81919925 TTTTGGGGCTTTGCAGTTCCTGG - Intergenic
1028052170 7:86202124-86202146 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1028053002 7:86208120-86208142 CTTTGGAGCTCTGCAGTTTCTGG - Intergenic
1028054445 7:86225450-86225472 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1028128860 7:87147122-87147144 TTGGGGGGCTCTGCAGTTGCTGG - Intergenic
1028502714 7:91536579-91536601 CCATGTGGCTCTGCAGTGCCTGG + Intergenic
1029899416 7:104023100-104023122 CTTTGGGGCCCTGCAGTTCCTGG + Intergenic
1030243954 7:107360542-107360564 CTTTGGGATTCTGCAGTTCCTGG + Intronic
1030359545 7:108580318-108580340 CTTTGGGGCTCTATAGTTCCTGG + Intergenic
1030484398 7:110148384-110148406 CTTTGGGGTTCTGCAGTTCCTGG - Intergenic
1031836948 7:126690490-126690512 TCTTGGGGCTCTGCGGTTCCTGG - Intronic
1032334387 7:131011568-131011590 CAGTGGGGCCCAGCAGGTCTGGG - Intergenic
1032419656 7:131767883-131767905 CTGTGGAGCACTGCAGTTACTGG - Intergenic
1032591106 7:133193268-133193290 CTTTGGGGCTCTGTAGTTCCTGG - Intergenic
1032658240 7:133954973-133954995 CTTTGGGGCTCCGCAGTTCCTGG - Intronic
1034215792 7:149404758-149404780 CTTTGGGGCTCTGCGGTTCCTGG - Intergenic
1036796754 8:11761665-11761687 CTGGGGGGCTCTGCAGTGCGGGG - Exonic
1036915370 8:12799268-12799290 TTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1037753774 8:21698739-21698761 GAGTGGGGGTCTGCTGTGCCTGG - Intronic
1038044621 8:23755644-23755666 CAGTGGGTCACTGCAGTTGGTGG + Intergenic
1038749126 8:30279941-30279963 CAGCGGTGGTTTGCAGTTCCAGG + Intergenic
1039210065 8:35204008-35204030 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1039211029 8:35215010-35215032 CTTTGGGGCCCTGCGGTTCCTGG - Intergenic
1039589915 8:38737590-38737612 CAGTGAGGCAATGCTGTTCCTGG - Intronic
1040786815 8:51176378-51176400 ACTTGGGGCTCTGCAGTTGCTGG - Intergenic
1041222443 8:55665255-55665277 ATTTGGGGCTCTGTAGTTCCTGG - Intergenic
1041274497 8:56143087-56143109 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1041342974 8:56865595-56865617 CAGTGATGCTCTGCAGTGTCTGG - Intergenic
1041780762 8:61576216-61576238 CAGTGGGTTTATGCAGTTACAGG + Intronic
1041956106 8:63559309-63559331 TTTAGGGGCTCTGCAGTTCCTGG - Intergenic
1042005004 8:64169934-64169956 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1042336953 8:67639590-67639612 CTTTAGGGCTCTGCAGTTCCTGG - Intronic
1042439586 8:68810408-68810430 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1042643013 8:70955977-70955999 CTTTGGAGCTCTGCATTTCCTGG - Intergenic
1042733062 8:71958150-71958172 CAGTGGGCCTCTGGAACTCCAGG - Intronic
1042954274 8:74232102-74232124 CAGTGGAGGTCTTCAGTTTCAGG - Intergenic
1043195635 8:77288291-77288313 CTCTGCGGCTCTGCAGTTCCTGG + Intergenic
1043662220 8:82758190-82758212 CCTTGGGGCTCTGCAGTTGCTGG - Intergenic
1043666922 8:82826058-82826080 CATTGGGGATCTGCAGTTCCTGG + Intergenic
1043702765 8:83312303-83312325 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1043707969 8:83377620-83377642 CTTTGGGGCTCTGCAGTTTCTGG - Intergenic
1043750243 8:83925906-83925928 CTTTGGGGCTCTACAGTTCCTGG - Intergenic
1043758396 8:84032311-84032333 CTCTGGGGCTCTGCAGCTTCTGG + Intergenic
1044613981 8:94120537-94120559 CTTTGGGGCTCTGCAGTCCCTGG + Intergenic
1044774864 8:95677638-95677660 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1046195817 8:110861262-110861284 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1046407246 8:113790608-113790630 CTTTGGGGCTCTGTGGTTCCCGG - Intergenic
1046674567 8:117094063-117094085 CTTTGGGGCTCTGCAGTTCTTGG - Intronic
1047099073 8:121657048-121657070 CAGAGGGGCTCCTCACTTCCCGG + Intergenic
1047402436 8:124558001-124558023 CATTGGGGCTCTGCTGCTCACGG + Intronic
1047543813 8:125796726-125796748 CTTTGGGGCTCTGCGGTTCCTGG - Intergenic
1048281130 8:133106332-133106354 TACTGAGGCTCTGCAGTGCCTGG + Intronic
1049063586 8:140295394-140295416 CAGTGGGGAGCTGCAGGGCCAGG + Intronic
1049140566 8:140950303-140950325 CTTTGGGGCTTTGCAGTTCCTGG + Intronic
1049394213 8:142391568-142391590 CTTTGGGGCTCTGCGGTTCCTGG + Intronic
1050182419 9:2934956-2934978 CTTTGGGGCCCTGCAGTTCCTGG + Intergenic
1050589565 9:7148203-7148225 CTCTGGGGCTCTGCACTTCCTGG - Intergenic
1050937303 9:11414251-11414273 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1050942082 9:11472260-11472282 CTTTGGGGCTCTGCGGTTCCTGG + Intergenic
1051891475 9:21946658-21946680 CAGGGGTTCTCTGCATTTCCTGG - Intronic
1052609774 9:30758155-30758177 CTTTGGGGCTCTGCCATTCCTGG - Intergenic
1052623607 9:30944889-30944911 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1052652301 9:31320840-31320862 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1052691546 9:31821595-31821617 CTTGGGGGCTCTGCAGTTTCTGG + Intergenic
1053293920 9:36899819-36899841 CAGTGGAGCCCTGAAGCTCCAGG - Intronic
1055890827 9:81122135-81122157 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1056750441 9:89346966-89346988 CAGTGGGGCGCTGGAGTCCAAGG - Exonic
1057510741 9:95677931-95677953 TTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1057807326 9:98228897-98228919 CAGTGGACCCCTCCAGTTCCTGG - Intronic
1058198616 9:102009948-102009970 CAGGGGCTCTCTGCATTTCCAGG - Intergenic
1058487587 9:105457978-105458000 CCTTGGGGCTCTGCAGTTACTGG - Intronic
1058659734 9:107257195-107257217 CAGAGGGGCTCCTCACTTCCCGG + Intergenic
1059401321 9:114072207-114072229 CTTTGGGGCCCTGCAGTTCTTGG + Intronic
1059845543 9:118271623-118271645 CTGTGGCCATCTGCAGTTCCAGG - Intergenic
1059852968 9:118364192-118364214 CTTTGGGGCTCTGCAGCTCCTGG + Intergenic
1060011361 9:120045521-120045543 CAGTCTGGCTCTGCACTTCAGGG - Intergenic
1060526529 9:124324130-124324152 GAGTGGGTCTCTGCACTGCCAGG - Intronic
1061079446 9:128361257-128361279 CAGTGGGGCTGTGGGGTTCTGGG - Exonic
1061743134 9:132721998-132722020 CTCTGGGGCTCTGTGGTTCCTGG - Intergenic
1061882210 9:133574142-133574164 CAGTGGGGCTCGGCCATGCCGGG - Intronic
1062049753 9:134441142-134441164 GAGTGGGGCTCTGAAGGTCCAGG + Intergenic
1062329215 9:136029625-136029647 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
1062352647 9:136146864-136146886 AAGGGGGGCTCTGCGGGTCCTGG - Intergenic
1062674398 9:137731985-137732007 CCTTGGGGCTCTGCAGTTGCTGG - Intronic
1185623093 X:1465352-1465374 CACCGGGCCTCTGCAGTGCCTGG + Exonic
1185936057 X:4257991-4258013 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1186223547 X:7374681-7374703 CTTTGGGATTCTGCAGTTCCTGG - Intergenic
1187871119 X:23766298-23766320 CTTTGGGGCTCTGCGGTTTCTGG - Intronic
1188195021 X:27222665-27222687 CTTTGGGACTCTGCGGTTCCTGG + Intergenic
1188207867 X:27381441-27381463 CTCTGGGGCTCTTCAGTTCCTGG + Intergenic
1188647966 X:32592802-32592824 CCTTGGGGCTCTGTGGTTCCTGG + Intronic
1189186592 X:39060423-39060445 CTTTGGGGCTCTGTAGTTGCTGG - Intergenic
1189265708 X:39714627-39714649 GAGAGGAGCTCTGGAGTTCCTGG + Intergenic
1189873185 X:45405403-45405425 CAGGGGTTCTCTGCATTTCCTGG - Intergenic
1190060911 X:47211194-47211216 CATTGGCGCTCTGCAGCTCCTGG - Exonic
1190299897 X:49051042-49051064 CAGTCTGGGTCTGCAGTTCTGGG + Intergenic
1190327818 X:49217628-49217650 CTGAGGGCCTCTGCAGTTCTTGG + Intronic
1191016459 X:55814343-55814365 CTTTGGGGCTCTGCAGTCCTAGG + Intergenic
1192098681 X:68240131-68240153 TAGTGGGGCTCTCCAGTACTGGG + Intronic
1192267289 X:69547514-69547536 CTTTGGGGCTCTGAGGTTCCTGG + Intergenic
1192569458 X:72190973-72190995 CAGTAGGGCCCAGCAGTTCTGGG - Intronic
1193417518 X:81241745-81241767 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
1193467516 X:81867181-81867203 CTTTGGGGCCCTGCAGTTACTGG - Intergenic
1194000315 X:88420484-88420506 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1195178445 X:102333525-102333547 CTTTGAGGCACTGCAGTTCCTGG - Intergenic
1195180419 X:102353558-102353580 CTTTGAGGCACTGCAGTTCCTGG + Intergenic
1195880218 X:109585869-109585891 TGTTGGGGCTGTGCAGTTCCTGG - Intergenic
1195974424 X:110510878-110510900 GGGTGGGGATATGCAGTTCCTGG - Intergenic
1196567083 X:117220866-117220888 CAGTTGGGCAGTGCTGTTCCAGG + Intergenic
1197035765 X:121871123-121871145 CTTTAGGGCTCTGCATTTCCGGG + Intergenic
1197378501 X:125710499-125710521 CTTTGGGGTTTTGCAGTTCCTGG + Intergenic
1197998997 X:132412322-132412344 CAGGAGGGCCCTGCATTTCCAGG + Intronic
1199187907 X:144938777-144938799 CTTTAGGGCTTTGCAGTTCCTGG - Intergenic
1199614885 X:149648410-149648432 CTTTGGGGCCTTGCAGTTCCTGG + Intergenic
1200238232 X:154479358-154479380 CAGTGAGGCCCTGCGGTGCCTGG + Intergenic
1200977278 Y:9226788-9226810 CACTGGGGCTCTCCAGTTTCTGG - Intergenic
1201593076 Y:15636944-15636966 CTTTGGGGTTCTGCACTTCCTGG - Intergenic
1201763723 Y:17562077-17562099 CAGTGGGGTTCTGGAGTCGCTGG - Intergenic
1201837830 Y:18343913-18343935 CAGTGGGGTTCTGGAGTCGCTGG + Intergenic
1202133526 Y:21636103-21636125 CTCTGGGGCTCTCCAGTTTCTGG + Intergenic