ID: 1075138206

View in Genome Browser
Species Human (GRCh38)
Location 10:119806423-119806445
Sequence GGACCACGTTGGTGCGATCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 278}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075138206_1075138212 13 Left 1075138206 10:119806423-119806445 CCTGGATCGCACCAACGTGGTCC 0: 1
1: 0
2: 0
3: 11
4: 278
Right 1075138212 10:119806459-119806481 GAGAGTGGTCATGGAACAGCAGG 0: 1
1: 0
2: 0
3: 12
4: 164
1075138206_1075138210 4 Left 1075138206 10:119806423-119806445 CCTGGATCGCACCAACGTGGTCC 0: 1
1: 0
2: 0
3: 11
4: 278
Right 1075138210 10:119806450-119806472 TGCCATCGCGAGAGTGGTCATGG 0: 1
1: 0
2: 1
3: 6
4: 43
1075138206_1075138213 21 Left 1075138206 10:119806423-119806445 CCTGGATCGCACCAACGTGGTCC 0: 1
1: 0
2: 0
3: 11
4: 278
Right 1075138213 10:119806467-119806489 TCATGGAACAGCAGGTAATTTGG 0: 1
1: 0
2: 0
3: 17
4: 149
1075138206_1075138209 -2 Left 1075138206 10:119806423-119806445 CCTGGATCGCACCAACGTGGTCC 0: 1
1: 0
2: 0
3: 11
4: 278
Right 1075138209 10:119806444-119806466 CCAAGCTGCCATCGCGAGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075138206 Original CRISPR GGACCACGTTGGTGCGATCC AGG (reversed) Exonic