ID: 1075138207

View in Genome Browser
Species Human (GRCh38)
Location 10:119806434-119806456
Sequence GATGGCAGCTTGGACCACGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 162}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075138207_1075138210 -7 Left 1075138207 10:119806434-119806456 CCAACGTGGTCCAAGCTGCCATC 0: 1
1: 0
2: 1
3: 25
4: 162
Right 1075138210 10:119806450-119806472 TGCCATCGCGAGAGTGGTCATGG 0: 1
1: 0
2: 1
3: 6
4: 43
1075138207_1075138214 20 Left 1075138207 10:119806434-119806456 CCAACGTGGTCCAAGCTGCCATC 0: 1
1: 0
2: 1
3: 25
4: 162
Right 1075138214 10:119806477-119806499 GCAGGTAATTTGGAGTCTGTTGG 0: 1
1: 0
2: 0
3: 21
4: 306
1075138207_1075138212 2 Left 1075138207 10:119806434-119806456 CCAACGTGGTCCAAGCTGCCATC 0: 1
1: 0
2: 1
3: 25
4: 162
Right 1075138212 10:119806459-119806481 GAGAGTGGTCATGGAACAGCAGG 0: 1
1: 0
2: 0
3: 12
4: 164
1075138207_1075138213 10 Left 1075138207 10:119806434-119806456 CCAACGTGGTCCAAGCTGCCATC 0: 1
1: 0
2: 1
3: 25
4: 162
Right 1075138213 10:119806467-119806489 TCATGGAACAGCAGGTAATTTGG 0: 1
1: 0
2: 0
3: 17
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075138207 Original CRISPR GATGGCAGCTTGGACCACGT TGG (reversed) Exonic