ID: 1075138210

View in Genome Browser
Species Human (GRCh38)
Location 10:119806450-119806472
Sequence TGCCATCGCGAGAGTGGTCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 43}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075138207_1075138210 -7 Left 1075138207 10:119806434-119806456 CCAACGTGGTCCAAGCTGCCATC 0: 1
1: 0
2: 1
3: 25
4: 162
Right 1075138210 10:119806450-119806472 TGCCATCGCGAGAGTGGTCATGG 0: 1
1: 0
2: 1
3: 6
4: 43
1075138206_1075138210 4 Left 1075138206 10:119806423-119806445 CCTGGATCGCACCAACGTGGTCC 0: 1
1: 0
2: 0
3: 11
4: 278
Right 1075138210 10:119806450-119806472 TGCCATCGCGAGAGTGGTCATGG 0: 1
1: 0
2: 1
3: 6
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075138210 Original CRISPR TGCCATCGCGAGAGTGGTCA TGG Exonic
901915388 1:12495490-12495512 TGCCATGAGGAGAGTGGACAAGG + Intronic
908606314 1:65800765-65800787 TGCAATAGTAAGAGTGGTCACGG + Intronic
915526304 1:156478388-156478410 TGCCATTCCCAGAGTGGTCCGGG - Intronic
923425623 1:233865972-233865994 TGCTATAGATAGAGTGGTCAGGG - Intergenic
1064128048 10:12681360-12681382 TGCCAGCAGGAGAGTGATCATGG - Intronic
1064253587 10:13725654-13725676 GGCCATCCCGAGACTGGTCTGGG - Intronic
1075138210 10:119806450-119806472 TGCCATCGCGAGAGTGGTCATGG + Exonic
1075756660 10:124817661-124817683 TGACAGTGGGAGAGTGGTCAGGG - Intronic
1075867399 10:125736858-125736880 TGCTTTGGCCAGAGTGGTCAGGG - Intronic
1081831439 11:46119721-46119743 CACCATCGCGAACGTGGTCAGGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1102953854 12:117046946-117046968 TGCCAAAGCCAGAGGGGTCAGGG + Intronic
1117793099 14:59361699-59361721 TGCCAGCGAGAGAGGGGGCAGGG + Intronic
1121512463 14:94522532-94522554 AGCCATGGCGAGTGTGGTCAGGG + Intergenic
1133101824 16:3484645-3484667 TGCCCTGGCGAGCGTGGTCAGGG + Intronic
1134336713 16:13306556-13306578 TGCCATCAAGATATTGGTCAGGG + Intergenic
1136077839 16:27828980-27829002 TGCCATCGTGAGGGTGGGCAAGG + Intronic
1138830089 16:60364957-60364979 GGCCATGGAGAGAGTTGTCAAGG + Intergenic
1139505676 16:67396971-67396993 AGCCATGGCGAGAGAGGACAGGG - Intronic
1140227915 16:73093514-73093536 TGACAGCCCGAGAGTGGACAGGG - Intergenic
1146649549 17:34598271-34598293 TGCCATGGGGAGAGGGGTCTGGG + Intronic
1150160465 17:62893850-62893872 TGCCATTGCCAGAGTGGACTGGG - Intergenic
1152210500 17:79000679-79000701 TGCCAGGGCCAGTGTGGTCAGGG - Intronic
1158385765 18:56989825-56989847 TGCCATCGAGAGAGCAGTCAAGG - Intronic
1168158569 19:54492821-54492843 TGCCATGCCAAGACTGGTCAAGG - Intergenic
1168332675 19:55579228-55579250 GGCCATCGAGAGGGTGGCCAAGG - Exonic
925804199 2:7632167-7632189 TGCCATGGAGACAGTGGTCTCGG + Intergenic
930052592 2:47228249-47228271 TACCACCCTGAGAGTGGTCATGG + Intergenic
931760312 2:65410936-65410958 TGCCATCGGGACAGGGGTCATGG + Intronic
932312562 2:70755382-70755404 TGCTTTAGCCAGAGTGGTCAGGG - Intronic
941978123 2:171427673-171427695 TGCTTTAGCCAGAGTGGTCAGGG - Intronic
1169031993 20:2416756-2416778 TGCCATGTAGAGAGTGGTAAGGG + Intronic
1173559007 20:43989049-43989071 TGCTATCCCCAGTGTGGTCATGG + Intronic
1175112355 20:56657585-56657607 TCCCTTAGCGAGAGTGGTCAGGG + Intergenic
1179967400 21:44815438-44815460 TGGCATCCCGGGAGTGGGCAGGG - Intronic
958889811 3:99770926-99770948 TGCCTTCGCCAGAGTGGTCAAGG + Intronic
961942123 3:130649112-130649134 TGACATCCCGGGAGTGGTCCAGG - Exonic
968001920 3:195212176-195212198 TGCCACCGGGAGAGTGGCCCAGG + Intronic
972751045 4:41989816-41989838 TACCATAGCTAGGGTGGTCAAGG + Intergenic
998811801 5:145974010-145974032 TGCCATCAAGAGGTTGGTCAGGG + Intronic
1024291460 7:47807501-47807523 TCCCATCTAGAGGGTGGTCAGGG - Intronic
1027861276 7:83585199-83585221 TGGGATGGTGAGAGTGGTCAGGG - Intronic
1034653085 7:152707658-152707680 TGACATCCCGGGAGTGGTAAAGG + Intergenic
1051791334 9:20806084-20806106 TGACATGGCAAGAGTGGTCCAGG - Intronic
1053567785 9:39271213-39271235 TGTCATCGGGTGAGCGGTCAAGG - Intronic
1053833797 9:42112160-42112182 TGTCATCGGGTGAGCGGTCAAGG - Intronic
1054129358 9:61347786-61347808 TGTCATCGGGTGAGCGGTCAAGG + Intergenic
1054596757 9:67075250-67075272 TGTCATCGGGTGAGCGGTCAAGG + Intergenic
1187710418 X:22047705-22047727 TGTCATTGCTAGAGTGGCCATGG - Intronic
1192005255 X:67204776-67204798 TGCCCTCGCCTGAGTGGTCCAGG - Intergenic