ID: 1075138210

View in Genome Browser
Species Human (GRCh38)
Location 10:119806450-119806472
Sequence TGCCATCGCGAGAGTGGTCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 43}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075138207_1075138210 -7 Left 1075138207 10:119806434-119806456 CCAACGTGGTCCAAGCTGCCATC 0: 1
1: 0
2: 1
3: 25
4: 162
Right 1075138210 10:119806450-119806472 TGCCATCGCGAGAGTGGTCATGG 0: 1
1: 0
2: 1
3: 6
4: 43
1075138206_1075138210 4 Left 1075138206 10:119806423-119806445 CCTGGATCGCACCAACGTGGTCC 0: 1
1: 0
2: 0
3: 11
4: 278
Right 1075138210 10:119806450-119806472 TGCCATCGCGAGAGTGGTCATGG 0: 1
1: 0
2: 1
3: 6
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075138210 Original CRISPR TGCCATCGCGAGAGTGGTCA TGG Exonic