ID: 1075139495

View in Genome Browser
Species Human (GRCh38)
Location 10:119818610-119818632
Sequence GATGGAGCGCGCATGCGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075139488_1075139495 17 Left 1075139488 10:119818570-119818592 CCGGGGTCTGTGCCCTCGTTGGT No data
Right 1075139495 10:119818610-119818632 GATGGAGCGCGCATGCGCACTGG No data
1075139484_1075139495 26 Left 1075139484 10:119818561-119818583 CCCGCCGGGCCGGGGTCTGTGCC No data
Right 1075139495 10:119818610-119818632 GATGGAGCGCGCATGCGCACTGG No data
1075139485_1075139495 25 Left 1075139485 10:119818562-119818584 CCGCCGGGCCGGGGTCTGTGCCC No data
Right 1075139495 10:119818610-119818632 GATGGAGCGCGCATGCGCACTGG No data
1075139486_1075139495 22 Left 1075139486 10:119818565-119818587 CCGGGCCGGGGTCTGTGCCCTCG No data
Right 1075139495 10:119818610-119818632 GATGGAGCGCGCATGCGCACTGG No data
1075139483_1075139495 27 Left 1075139483 10:119818560-119818582 CCCCGCCGGGCCGGGGTCTGTGC No data
Right 1075139495 10:119818610-119818632 GATGGAGCGCGCATGCGCACTGG No data
1075139492_1075139495 4 Left 1075139492 10:119818583-119818605 CCTCGTTGGTAGGCGTAGGATGC No data
Right 1075139495 10:119818610-119818632 GATGGAGCGCGCATGCGCACTGG No data
1075139482_1075139495 28 Left 1075139482 10:119818559-119818581 CCCCCGCCGGGCCGGGGTCTGTG No data
Right 1075139495 10:119818610-119818632 GATGGAGCGCGCATGCGCACTGG No data
1075139491_1075139495 5 Left 1075139491 10:119818582-119818604 CCCTCGTTGGTAGGCGTAGGATG No data
Right 1075139495 10:119818610-119818632 GATGGAGCGCGCATGCGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075139495 Original CRISPR GATGGAGCGCGCATGCGCAC TGG Intronic