ID: 1075140826

View in Genome Browser
Species Human (GRCh38)
Location 10:119833639-119833661
Sequence TCTCACTGTATCACCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336754
Summary {0: 95, 1: 3195, 2: 42548, 3: 101881, 4: 189035}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075140826_1075140831 3 Left 1075140826 10:119833639-119833661 CCAGCCTGGGTGATACAGTGAGA 0: 95
1: 3195
2: 42548
3: 101881
4: 189035
Right 1075140831 10:119833665-119833687 CACTGACCAAATAAAATGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075140826 Original CRISPR TCTCACTGTATCACCCAGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr