ID: 1075140827

View in Genome Browser
Species Human (GRCh38)
Location 10:119833643-119833665
Sequence GGGGTCTCACTGTATCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140231
Summary {0: 4, 1: 182, 2: 3400, 3: 31921, 4: 104724}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075140827_1075140831 -1 Left 1075140827 10:119833643-119833665 CCTGGGTGATACAGTGAGACCCC 0: 4
1: 182
2: 3400
3: 31921
4: 104724
Right 1075140831 10:119833665-119833687 CACTGACCAAATAAAATGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075140827 Original CRISPR GGGGTCTCACTGTATCACCC AGG (reversed) Intronic
Too many off-targets to display for this crispr