ID: 1075140831

View in Genome Browser
Species Human (GRCh38)
Location 10:119833665-119833687
Sequence CACTGACCAAATAAAATGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075140827_1075140831 -1 Left 1075140827 10:119833643-119833665 CCTGGGTGATACAGTGAGACCCC 0: 4
1: 182
2: 3400
3: 31921
4: 104724
Right 1075140831 10:119833665-119833687 CACTGACCAAATAAAATGTCTGG No data
1075140826_1075140831 3 Left 1075140826 10:119833639-119833661 CCAGCCTGGGTGATACAGTGAGA 0: 95
1: 3195
2: 42548
3: 101881
4: 189035
Right 1075140831 10:119833665-119833687 CACTGACCAAATAAAATGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075140831 Original CRISPR CACTGACCAAATAAAATGTC TGG Intronic
No off target data available for this crispr