ID: 1075145542

View in Genome Browser
Species Human (GRCh38)
Location 10:119879849-119879871
Sequence CTGCATATACAAACAGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 4, 2: 12, 3: 65, 4: 333}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075145542 Original CRISPR CTGCATATACAAACAGACAA TGG (reversed) Intronic
900879475 1:5370364-5370386 CTGAATATGCAAACAAACAATGG + Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903327503 1:22578696-22578718 ATGCATATACATACACACACAGG - Intronic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904579091 1:31526811-31526833 GTACAAATACAAACAAACAAAGG - Intergenic
905966960 1:42106533-42106555 ATGCATATACAAACATACGTGGG + Intergenic
906337819 1:44949404-44949426 CTGAATATACAAAGATAAAAGGG - Intronic
906435294 1:45790590-45790612 GTGTATATACACACACACAATGG + Intronic
906817384 1:48893000-48893022 CTGCATATACACAGACAGAAAGG + Intronic
906842115 1:49150438-49150460 ATGCATAGAAAAAAAGACAAAGG + Intronic
907536146 1:55160026-55160048 CTGAATATAAACACAGACCATGG + Intronic
907612273 1:55883812-55883834 CAGCATATATAAACCAACAAAGG - Intergenic
907850073 1:58247838-58247860 CTTCAAATACAACCAGACAGTGG - Intronic
908244285 1:62215393-62215415 CTCAATATACAAACATACAATGG - Intergenic
909675145 1:78231137-78231159 CTGAATATAGAAGCAGACATAGG + Intergenic
916368306 1:164059401-164059423 CTGCTATTACAAACAAACAAAGG - Intergenic
916477244 1:165181982-165182004 CAGGATATATAAATAGACAAAGG + Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917942917 1:179941144-179941166 ATGTATATACAAATAGACTATGG + Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919126061 1:193395304-193395326 CTGAATATGGAAACAGACAATGG + Intergenic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
920646729 1:207809192-207809214 TTGCATATAAAAAAAGAGAAAGG - Intergenic
921330970 1:214035626-214035648 CTGCTGATACAAGGAGACAATGG - Intronic
921762560 1:218932977-218932999 CTCCATATAGAAACAGACTGAGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922426220 1:225497760-225497782 CTGCATAGAGGAACAGACTAAGG - Exonic
924049035 1:240061787-240061809 CAGAATAAACAAACAGACAATGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1063033525 10:2261079-2261101 TTGAATATATAAACAAACAATGG - Intergenic
1063882234 10:10542942-10542964 CTGAAAATACAGACTGACAATGG - Intergenic
1063962280 10:11316635-11316657 CTCCATATGGAAACAGATAATGG - Intronic
1064771721 10:18730294-18730316 CTGCAAATGCACACAGAAAAGGG - Intergenic
1064789584 10:18941114-18941136 ATACATATACATACACACAATGG + Intergenic
1066150824 10:32614998-32615020 ATGCATATACACACACACTATGG - Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067071230 10:43133729-43133751 CTGAACATGCAAACAGACAATGG - Intergenic
1068632957 10:59316690-59316712 TTGCATATCTAAACATACAAAGG + Intronic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1069032903 10:63616975-63616997 GTACATATAGAAACAAACAAAGG - Intronic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1072575559 10:96696710-96696732 CTTCATATCCACACAGATAATGG + Intronic
1073522486 10:104146672-104146694 CTGGATATACATGCAAACAAGGG + Intronic
1073860952 10:107739486-107739508 GTGTATATACATACATACAATGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1075154076 10:119959477-119959499 CTAAATAAACAAACAAACAAAGG - Intergenic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1080237363 11:30086618-30086640 AAAAATATACAAACAGACAATGG - Intergenic
1081685046 11:45036480-45036502 CTGCAAATACTAAAAGATAATGG - Intergenic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1081902424 11:46640316-46640338 CTGAATATACTAACAGACAGTGG - Intronic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1083468518 11:62865671-62865693 AAGCATCTACAAACAGAAAAAGG - Intronic
1085262839 11:75218122-75218144 CTACATATAGAGAAAGACAAGGG - Intergenic
1085944903 11:81257257-81257279 CTTCATATTCATACAGCCAAAGG - Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1090037716 11:123263282-123263304 CTGGCTATACTAACGGACAATGG - Intergenic
1090863475 11:130674713-130674735 CTGCAAAAACAAAAATACAATGG - Intronic
1091239199 11:134041301-134041323 CTACATTTGAAAACAGACAAGGG - Intergenic
1092388685 12:8055752-8055774 CTCCATATACCAACCTACAAGGG - Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094001946 12:25705196-25705218 CTGAATATTCAAACAGCCAATGG + Intergenic
1094757368 12:33487983-33488005 TTGCATATCCAAACATATAAAGG - Intergenic
1094794592 12:33956490-33956512 CTAAATATACAAACCAACAATGG + Intergenic
1095106448 12:38239104-38239126 CTAAATATACAAACCAACAATGG + Intergenic
1095535273 12:43238557-43238579 CTGAATACACAAACAGATAATGG - Intergenic
1095680936 12:44974674-44974696 CTATATATACATACATACAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1095854263 12:46843245-46843267 TTGCATATAGAAAGAGACAATGG - Intergenic
1096139632 12:49232334-49232356 GTTCATATCCAAACAGAAAATGG - Intronic
1097284027 12:57864050-57864072 CTGCCTCTTCAAACAGACACTGG - Intergenic
1097651208 12:62299054-62299076 AAGCAAATACATACAGACAAAGG - Intronic
1098057204 12:66520619-66520641 CTGGATATACACACAGATAGTGG + Intronic
1098992569 12:77080117-77080139 CTGAATATACAGACAAAAAAAGG - Intergenic
1099012165 12:77304376-77304398 ATGCATATATAAAAAGGCAAAGG - Intergenic
1099219840 12:79900323-79900345 ATGCATATAGAAACATACAGAGG + Intronic
1099826397 12:87782121-87782143 CTACATATACATACACACACTGG + Intergenic
1101381591 12:104217945-104217967 GTACATATACACACACACAATGG - Intronic
1101726796 12:107394835-107394857 CTGCAAATACAAGCAGGCCAGGG + Intronic
1103840184 12:123857290-123857312 CTGCAAAAACAAAAAGCCAATGG - Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106355003 13:28973371-28973393 CTGCATATATAAACATCTAATGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108083158 13:46758061-46758083 GTGCATATCCAAACAAACATTGG + Intergenic
1108550326 13:51537592-51537614 CAGCATATGCAAAGAAACAAAGG - Intergenic
1108915027 13:55597926-55597948 CTCCAGATACAGAGAGACAATGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1110275365 13:73636007-73636029 CTGCACATGCAGACAGCCAAAGG + Intergenic
1110661716 13:78065515-78065537 CCGAATATGCAAACAGACAGTGG + Intergenic
1111815693 13:93149998-93150020 CTGCCTGTACAAACAGACCATGG + Intergenic
1112159486 13:96853047-96853069 CTGACTATAGGAACAGACAAGGG + Intergenic
1112505861 13:99975269-99975291 CTGCAGAAACAATCAAACAAAGG - Intergenic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1114169308 14:20255807-20255829 CTGAATAAATAAACAGAAAAGGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115209228 14:30948430-30948452 CTGGGTATACAAACAACCAAAGG + Intronic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1117654916 14:57945231-57945253 ATGCATCCACAAACAGACAATGG + Intronic
1119322849 14:73741844-73741866 CTTCATATATGAAAAGACAAAGG - Intronic
1119436616 14:74601611-74601633 CTGCATCTTCAAACAGGCAGAGG + Intronic
1119541932 14:75444848-75444870 CTGCATAAACAACCAGAAACTGG - Intronic
1119637024 14:76281710-76281732 ATACATATACACACACACAATGG + Intergenic
1120290071 14:82556929-82556951 CAGGATATACAAAAAGCCAATGG - Intergenic
1121887473 14:97557012-97557034 CTGCAAATACATCCACACAAAGG + Intergenic
1122967071 14:105136336-105136358 CTGCATATAAAAAAAAAAAATGG - Intergenic
1123475545 15:20590244-20590266 CTGTATACACATACAGACATGGG - Intergenic
1123627992 15:22240664-22240686 CTGCTTATAAAATCAGAAAATGG - Intergenic
1123642466 15:22410119-22410141 CTGTATACACATACAGACATGGG + Intergenic
1123828907 15:24113341-24113363 ATGTATAAACAAACAGAAAAGGG - Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124580274 15:30947302-30947324 TGGCAAATACAAAGAGACAATGG + Intronic
1125422476 15:39518469-39518491 ATGCATACACAACCAAACAAAGG - Intergenic
1126553235 15:49955630-49955652 ATGAATAGACAAACAGATAAGGG + Intronic
1127133497 15:55894455-55894477 CTGCAAATACCAAGAGACACCGG + Intronic
1128014929 15:64335473-64335495 CTGCCTATAGAAACACAAAAAGG + Intronic
1128115735 15:65103952-65103974 CTTCATATAAAAACAAATAAGGG + Intronic
1128204615 15:65839551-65839573 ATACATATATAAACAGAGAAGGG + Intronic
1129713039 15:77831000-77831022 CTGCCTATAAAAACAACCAAGGG + Intergenic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1132413971 15:101607297-101607319 CATCATATGCAAACAGACATAGG - Intergenic
1133410031 16:5560529-5560551 CAGGAGATTCAAACAGACAAAGG - Intergenic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1135995279 16:27243419-27243441 TTGAACATACAAACAGCCAATGG + Intronic
1138653764 16:58477957-58477979 CTGCTGATACAAACTGAGAAGGG + Intronic
1138792350 16:59920751-59920773 CTGAACATAAAAACAGGCAATGG - Intergenic
1140630214 16:76843276-76843298 CTGGATATACAAACAAATTAAGG - Intergenic
1141453089 16:84118731-84118753 CTGCATTTGCAAACCGTCAAAGG + Intergenic
1142386953 16:89771495-89771517 CTTCATACACAAACAGACTGTGG + Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1143674214 17:8419154-8419176 CTGCATATACAAGAAAATAAGGG - Intronic
1143872669 17:9968609-9968631 CTGATTATACTAACAGCCAATGG + Intronic
1144060662 17:11581123-11581145 CTGAATATGCAAGCAGACAATGG + Intergenic
1146841360 17:36157400-36157422 GTGCATACACCAACAGAAAAGGG - Intergenic
1146853610 17:36245037-36245059 GTGCATACACCAACAGAAAAGGG - Intronic
1146869519 17:36368929-36368951 GTGCATACACCAACAGAAAAGGG - Intronic
1147072394 17:37969553-37969575 GTGCATACACCAACAGAAAAGGG - Intergenic
1147083918 17:38049090-38049112 GTGCATACACCAACAGAAAAGGG - Intronic
1147099864 17:38173057-38173079 GTGCATACACCAACAGAAAAGGG - Intergenic
1150082871 17:62256347-62256369 GTGCATACACCAACAGAAAAGGG - Intergenic
1150545430 17:66152558-66152580 CTGCATAGACATAAAGCCAAGGG + Intronic
1150769217 17:68027247-68027269 CTTGGTATACAAACATACAATGG + Intergenic
1150899168 17:69251830-69251852 CTGCATTTAAAAACAGAAAGCGG - Exonic
1152656572 17:81522656-81522678 CTGCATCTACACACACACACAGG - Intronic
1153455540 18:5278033-5278055 CTGGATCTAATAACAGACAAAGG + Intergenic
1153545913 18:6204464-6204486 TTGCATATACCACCTGACAAAGG + Intronic
1153986612 18:10356664-10356686 TGGCATATACAAACCGACTATGG + Intergenic
1154128275 18:11713618-11713640 CTGAATATATAAACAGGCAATGG - Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1156303126 18:35852917-35852939 CAGACTATACAAGCAGACAATGG - Intergenic
1156575355 18:38308604-38308626 ATGCAAATACAAACAGATAATGG - Intergenic
1157015255 18:43704406-43704428 TTGAATATACGAACAGACAATGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157970693 18:52264627-52264649 CTACATATACATACACAAAATGG - Intergenic
1158156021 18:54426461-54426483 ATGTATATACACACATACAAAGG + Intergenic
1158512468 18:58103120-58103142 CTACATAGACAAATAGACAAAGG - Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159862052 18:73661042-73661064 CTGTACATACAAACAGATGATGG + Intergenic
1160613057 18:80104043-80104065 CTGAATGTGCCAACAGACAATGG + Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1164394170 19:27849597-27849619 ATACAAATTCAAACAGACAATGG - Intergenic
1168719333 19:58546193-58546215 CAGCATATGCAAACAGGGAAAGG + Intronic
925059876 2:882836-882858 CCTCAGATACAAACAAACAAAGG + Intergenic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
925853188 2:8104180-8104202 CTGAAAACACAAACAGGCAACGG + Intergenic
926038426 2:9653503-9653525 ATGCATATGGAAATAGACAAAGG - Intergenic
927036999 2:19188455-19188477 CTGCAGATAGAGACATACAAAGG - Intergenic
927091842 2:19718314-19718336 CTGTCTATACACACAGATAATGG - Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
928159644 2:28910527-28910549 CTCAAAATAAAAACAGACAAAGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929309723 2:40408385-40408407 CTGCAGATTCACACAAACAAAGG + Intronic
932271024 2:70410050-70410072 CTGGATATATATACACACAAAGG + Intergenic
932738114 2:74269996-74270018 CCCCATAGACACACAGACAAGGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933623933 2:84576736-84576758 CAGCATATGCAAATTGACAAAGG + Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935330148 2:101971219-101971241 GTGGATATACAAAAAGACAATGG - Intergenic
935684222 2:105669455-105669477 CTGAGCATACAAACAGTCAATGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935870641 2:107444862-107444884 TTTCCTATACAAACAAACAATGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938659807 2:133474182-133474204 ATACATATACACACACACAATGG + Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939728150 2:145749476-145749498 CTGTATGTTCAAACAAACAAAGG + Intergenic
939831950 2:147082803-147082825 GTGCATTTAGTAACAGACAATGG - Intergenic
940317337 2:152338866-152338888 TTGCACATACACACACACAAAGG - Intronic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
941953974 2:171185537-171185559 CAGCATATCCAAAGATACAAAGG - Intronic
942750387 2:179279895-179279917 TTGCATAAAAAAACAAACAAAGG - Intergenic
943719758 2:191191433-191191455 CTAGATATACAAAAGGACAATGG - Intergenic
944288622 2:197978909-197978931 CTGCAACTCCACACAGACAATGG + Intronic
944294116 2:198042852-198042874 TTGCATAAACAGACAGAGAAAGG + Intronic
944334980 2:198521730-198521752 CAACATATTCAAACATACAAGGG - Intronic
944626737 2:201577520-201577542 CTGTATATACATACATGCAATGG + Intronic
945256279 2:207806161-207806183 CTGCATTTAAAAACAGATACAGG - Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
946072528 2:217046784-217046806 CTGCTTATGAAGACAGACAATGG - Intergenic
946511626 2:220364022-220364044 CTGGATATACATACACACCATGG + Intergenic
946556078 2:220859174-220859196 CTGCACATGCAAACAGAGATGGG + Intergenic
946635348 2:221719016-221719038 CTGCATATACAAGCAGACAATGG + Intergenic
947276753 2:228400935-228400957 CAGCAAATACAAAAAGGCAAAGG - Intergenic
1170688473 20:18589846-18589868 CTGCATATTAAAAAAGATAAGGG + Intronic
1170815571 20:19711071-19711093 ATGCAGACACACACAGACAAAGG + Intronic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1172694192 20:36810601-36810623 CTCCATAAAAAAACATACAAAGG + Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1174714049 20:52737837-52737859 CTAGATAAACAAACAGACAGAGG + Intergenic
1174828052 20:53786870-53786892 TTTCATACACAAACATACAATGG + Intergenic
1174993771 20:55543029-55543051 CTGCATTTGCAGAAAGACAAGGG + Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177556094 21:22690543-22690565 GTGGATATAGAAACAGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178227207 21:30735162-30735184 GTCCATATACACACACACAATGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1181783442 22:25208958-25208980 CTAAATAAACAAACAAACAAAGG - Intergenic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
952174419 3:30846219-30846241 CTGCATTTAGAAACAAACAGTGG + Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
955775650 3:62430155-62430177 CTGCATACAAAAAAAGATAAGGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
957682189 3:83451275-83451297 CTGTATATGCAAATAAACAATGG + Intergenic
959050650 3:101521677-101521699 CTGAATATATGAAGAGACAATGG - Intergenic
959737063 3:109671456-109671478 CTGGATATAAAGACAGACATAGG + Intergenic
960428165 3:117534848-117534870 CTGCATAGTCAAAAACACAATGG + Intergenic
962379153 3:134883222-134883244 CTGCTTCTCTAAACAGACAATGG - Intronic
964692749 3:159470339-159470361 CTGTATACACAGACAGTCAAAGG + Intronic
964706114 3:159620464-159620486 CTGGATAAAGAAATAGACAATGG + Intronic
964896464 3:161602471-161602493 CTGCATATTCAGAGAGATAAAGG + Intergenic
965389860 3:168092115-168092137 CTGCCTATAGATACAGACAATGG + Intronic
965966201 3:174493315-174493337 TTGCATATAGACACAGACATAGG + Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
968247746 3:197170797-197170819 CTGGATATAGGAACAGGCAAAGG - Intronic
970316764 4:14835460-14835482 CTGACTATCCAAACAGACAATGG + Intergenic
970338136 4:15074508-15074530 CTGCATATACAGTTAGAAAAAGG + Intergenic
970701159 4:18740553-18740575 CTGCATATATAAACATAGAAAGG + Intergenic
971146163 4:23978981-23979003 TTGCATATAGAAAGAGACAGGGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971745295 4:30572196-30572218 GAGAATATACAAACAGACACTGG + Intergenic
971982853 4:33776128-33776150 AAGCAAATAAAAACAGACAATGG - Intergenic
975414136 4:74088325-74088347 ATGCATTTCCAAACAGATAAGGG - Intergenic
975593479 4:76023755-76023777 TTGCATATAGAAAAAAACAAAGG + Intronic
976246624 4:83012090-83012112 CTGCATATAAAAACAGCAATTGG - Intronic
977763467 4:100769852-100769874 CCACATATACAAACACACAAAGG - Intronic
977829228 4:101570771-101570793 TTGAATATATCAACAGACAATGG + Intronic
978038100 4:104021791-104021813 TTGAATATATAAACAGACAATGG + Intergenic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
979917686 4:126457545-126457567 TTGCATATAGATACAGACATAGG + Intergenic
980946517 4:139325923-139325945 TAGCATATAAAAACAGACAACGG - Intronic
981248894 4:142574785-142574807 CTGTATAAACAAACAAACAAAGG - Intronic
981887155 4:149690206-149690228 ATGTATATACACACACACAATGG + Intergenic
983387363 4:167082423-167082445 CTTTATTTACAAACAGACAATGG - Intronic
983836132 4:172387581-172387603 CATCATATACAAACTGTCAAAGG - Intronic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986863327 5:11953346-11953368 CTCCACATACAAATGGACAAAGG - Intergenic
987691667 5:21274847-21274869 CTGAATACACTAACAGACAATGG - Intergenic
988388307 5:30595086-30595108 AGACAAATACAAACAGACAAAGG - Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
988815181 5:34827500-34827522 TTCCATATACAAACAGAACATGG + Intronic
989546459 5:42680355-42680377 CTGCATATGCAGTCAAACAAGGG - Intronic
990797822 5:59564586-59564608 CTGCATATCCAAACAAGCACAGG + Intronic
991137483 5:63199211-63199233 ATGCACATACAAACAAACAATGG - Intergenic
991642897 5:68772256-68772278 GTACATAAACAAACAGAAAAAGG - Intergenic
991679514 5:69125044-69125066 CAGCACATATAAACAGGCAAAGG + Intronic
991748710 5:69775290-69775312 CTGAATACACTAACAGACAATGG + Intergenic
991800288 5:70355102-70355124 CTGAATACACTAACAGACAATGG + Intergenic
991828312 5:70654939-70654961 CTGAATACACTAACAGACAATGG - Intergenic
991892646 5:71354542-71354564 CTGAATACACTAACAGACAATGG + Intergenic
992756192 5:79908571-79908593 GTGTATATACACACAGACACAGG - Intergenic
993299559 5:86190793-86190815 TTGCATCTACAAATAGGCAAAGG + Intergenic
993518615 5:88869552-88869574 CTGCATATGCAGATAGATAATGG - Intronic
994320613 5:98390640-98390662 ATGCTTATGCAAACAGAAAAAGG - Intergenic
994540312 5:101086936-101086958 GTGTATATACACACACACAAAGG - Intergenic
995022135 5:107379030-107379052 CTGCATATATAAATAGCTAAAGG + Exonic
995977677 5:118060757-118060779 GTGTATATACATACACACAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997126568 5:131233082-131233104 GTGCATATACAAACACATACGGG + Intergenic
997715168 5:136037116-136037138 CTGCATTTACAAAGAGAGAAGGG + Intronic
997810061 5:136958281-136958303 CTAGATATACAAACAGAGAATGG - Intergenic
998192245 5:140036148-140036170 CTGCATATACAAAGTGGGAAGGG + Intronic
999724841 5:154428266-154428288 ATGTATATACAAACACACACAGG - Intergenic
1001264085 5:170259796-170259818 CTGCATAAATAAACACACATGGG + Intronic
1001425736 5:171621057-171621079 CTACACATAGAGACAGACAAGGG + Intergenic
1001552264 5:172611652-172611674 CTGCATCTACAGACAGACCTGGG - Intergenic
1002326603 5:178413896-178413918 CTGCAGATGGAAACAGACATTGG - Intronic
1003138217 6:3449481-3449503 CAGCATATACACACACATAAAGG + Intronic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1003783255 6:9453657-9453679 CTGCATACCCAAACAAACATAGG + Intergenic
1004233028 6:13850032-13850054 CTGAATATATAAACAGATGATGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1005315825 6:24601942-24601964 CTGGATATAAAAGCAGACAATGG - Intronic
1005736005 6:28747086-28747108 CTCCAAACACAGACAGACAAAGG - Intergenic
1005801866 6:29433671-29433693 TTGAATATATACACAGACAAGGG + Intronic
1006214245 6:32426125-32426147 CTGGATATAGAAACAGACAATGG + Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009568990 6:65356130-65356152 ATACATATACATACACACAATGG + Intronic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011639493 6:89405783-89405805 CTGCAAATAGAAACACACCAGGG - Intronic
1011812119 6:91144792-91144814 CTGCTTCTACATATAGACAATGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015208283 6:130666846-130666868 AAGCCTATACAAATAGACAATGG + Intergenic
1015444729 6:133289906-133289928 CTGCGAAAACAAACAAACAAAGG + Intronic
1015837101 6:137432333-137432355 ATGCTTAATCAAACAGACAAAGG - Intergenic
1016061281 6:139633745-139633767 TTGCATAAACAAACAGGCAAAGG + Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017199561 6:151737708-151737730 ATGCATATACAAGCAAAGAAGGG + Intronic
1017452563 6:154567336-154567358 CTGAATCAACAAACAAACAAGGG + Intergenic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018117075 6:160597483-160597505 CTGCACATATATACACACAATGG - Intronic
1018297535 6:162365209-162365231 ATACATATACACACAGATAAAGG - Intronic
1019519263 7:1453332-1453354 ATGCAGATACAAACTGACAGGGG + Intronic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1021267046 7:18537692-18537714 CTCCATATACAAAAATCCAATGG - Intronic
1021361564 7:19719384-19719406 GTGTATATACACACACACAATGG - Exonic
1021602386 7:22377434-22377456 CTGGATTTACAACCAGACATGGG + Intergenic
1021792659 7:24221590-24221612 AAGGATATACAAATAGACAATGG + Intergenic
1022592101 7:31673387-31673409 CTGAAAATAGAAACAGACAATGG - Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1026119848 7:67527187-67527209 CTCCATATACAAAATGAAAATGG + Intergenic
1027945492 7:84739743-84739765 CTGTATATATAAACTGAAAATGG + Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029701704 7:102250735-102250757 ACGCATATACACATAGACAAGGG - Exonic
1030504032 7:110397157-110397179 CTCCATATACATAGAGATAAAGG + Intergenic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1031209076 7:118798773-118798795 CTAAATATGCAAACAAACAATGG - Intergenic
1031619906 7:123923588-123923610 CTGCTTCTACAAACTGACAGAGG - Intergenic
1031719473 7:125153310-125153332 CAGGATATAGAAACACACAAGGG - Intergenic
1032112625 7:129089665-129089687 ATGAAAATACAAACAGACAATGG + Intergenic
1033344445 7:140516493-140516515 CTGCATGTATAAAGAGCCAAAGG + Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035556242 8:569297-569319 CCGAATATGCAAACAGACAAGGG - Intergenic
1037010222 8:13832806-13832828 CTTCTTATAGAAACTGACAAGGG - Intergenic
1037741137 8:21610149-21610171 CTGCACATACACACAGTCAAAGG + Intergenic
1037866260 8:22445487-22445509 CTGCAGATGGAAACACACAAAGG - Intronic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039625210 8:39043121-39043143 ATACATATACACACATACAATGG - Intronic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040465209 8:47688609-47688631 CTGCATGAACAAAGAGACTATGG - Intronic
1040730244 8:50436849-50436871 CTGCATATACAAAAGCAAAAAGG - Intronic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1046476216 8:114747619-114747641 CTGCATGTGTACACAGACAAAGG + Intergenic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051058363 9:13015359-13015381 ATGCATGTACAAACACACACAGG + Intergenic
1052644994 9:31223027-31223049 CTTTATATACAAACACACATAGG + Intergenic
1053601644 9:39616948-39616970 CTGAATATTAAAACAGACAGTGG + Intergenic
1053859292 9:42370715-42370737 CTGAATATTAAAACAGACAGTGG + Intergenic
1054251891 9:62725498-62725520 CTGAATATTAAAACAGACAGTGG - Intergenic
1054566004 9:66759999-66760021 CTGAATATTAAAACAGACAGTGG - Intergenic
1055699572 9:78928424-78928446 CTGAACATACCAACAAACAATGG + Intergenic
1056139639 9:83663331-83663353 TTGCATCTACAAACATACATTGG - Intronic
1056520077 9:87393027-87393049 CTGAATACACAAACAGATGATGG + Intergenic
1056602016 9:88053874-88053896 CTGAGTACACAAACAGACAATGG + Intergenic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1057334381 9:94144297-94144319 CTGCAAAAACAGGCAGACAAGGG - Intergenic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1057750196 9:97786648-97786670 CTGCCTATACAACAAGAGAATGG + Intergenic
1058125550 9:101190229-101190251 CTGCAAATACCTACAAACAATGG - Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1060038252 9:120277438-120277460 GTGCATACACAAACACACAGAGG - Intergenic
1186012164 X:5146719-5146741 ATGCATATACATACATACATAGG + Intergenic
1186620366 X:11234438-11234460 CTGGAAATACAAACAAACATTGG - Intronic
1187461742 X:19493080-19493102 AAGCAAATAGAAACAGACAAAGG + Intronic
1188339565 X:28982193-28982215 CTGTAAATTCAAACAGGCAATGG - Intronic
1188465890 X:30480609-30480631 CTGCAAAGGCAAACAGAAAAGGG - Intergenic
1188953387 X:36404963-36404985 CTGCAAATTGAAACAGACTAAGG + Intergenic
1189361178 X:40353221-40353243 CTGATAGTACAAACAGACAAAGG + Intergenic
1189502879 X:41580678-41580700 ATTCATATCCAAACAGAAAAAGG + Intronic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1191213543 X:57912748-57912770 GTGAATATACAAACAGAGCAAGG - Intergenic
1193371222 X:80699396-80699418 ATGCACATACAGACAGACATAGG - Intronic
1193426646 X:81347977-81347999 CTGAATATAGAGACAGACGATGG + Intergenic
1194153494 X:90356733-90356755 ATGAATACACACACAGACAAGGG + Intergenic
1194484139 X:94466160-94466182 CTGGACATAGAAACAGGCAAAGG + Intergenic
1195807055 X:108785803-108785825 TTGCATAAACCAACAGACTAGGG + Intergenic
1196977381 X:121174934-121174956 CTGCATATAAAAACTTAAAATGG - Intergenic
1197274693 X:124464698-124464720 CAGCATACACACACAGACACAGG + Intronic
1198805466 X:140490018-140490040 CTGAATAAACATACAGAAAATGG + Intergenic
1199204143 X:145128089-145128111 TCGAATATACAAACAGACAACGG + Intergenic
1199212516 X:145230205-145230227 ATGTATAAAAAAACAGACAAAGG + Intergenic
1199431606 X:147767375-147767397 CTTAATATACAAACAGGCACAGG - Intergenic
1199683320 X:150242565-150242587 ATGCATATACACACAGAGAGAGG - Intergenic
1200499830 Y:3933529-3933551 ATGAATACACACACAGACAACGG + Intergenic
1200781479 Y:7220248-7220270 CTGAAAATATAAACAGACAATGG + Intergenic
1200931754 Y:8703225-8703247 CTGCAGAAACACACAGCCAAGGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1202338891 Y:23839314-23839336 TTGCATATAATCACAGACAAAGG + Intergenic
1202531875 Y:25830758-25830780 TTGCATATAATCACAGACAAAGG - Intergenic