ID: 1075149098

View in Genome Browser
Species Human (GRCh38)
Location 10:119910643-119910665
Sequence ATGGAGAGGAGAAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1456
Summary {0: 1, 1: 1, 2: 9, 3: 151, 4: 1294}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075149098_1075149103 22 Left 1075149098 10:119910643-119910665 CCTTCCTCATTTCTCCTCTCCAT 0: 1
1: 1
2: 9
3: 151
4: 1294
Right 1075149103 10:119910688-119910710 GTTTGTTTTTTTAAGAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075149098 Original CRISPR ATGGAGAGGAGAAATGAGGA AGG (reversed) Intronic
900031158 1:373981-374003 ATGGAGAGGAGAAAGGAGACGGG - Intergenic
900031178 1:374053-374075 ATAGAGAGGAGAAAGGAGAGGGG - Intergenic
900031192 1:374102-374124 ATGGAGAGGAGAAAGGAGAGGGG - Intergenic
900051725 1:602230-602252 ATGGAGAGGAGAAAGGAGAGGGG - Intergenic
900051746 1:602302-602324 ATGGAGAGGAGAAAGGAGAGGGG - Intergenic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900288528 1:1914010-1914032 ATGGAGAGGAGAGAGGTTGATGG + Intergenic
900735781 1:4298634-4298656 ATGGAGTGGGTGAATGAGGAGGG + Intergenic
900867072 1:5276210-5276232 TTGGAGAGGAGCAGTGAGGCTGG - Intergenic
901074685 1:6546424-6546446 AAGGAGAGAAGAAATGAGAGTGG - Intronic
901248191 1:7750279-7750301 ATGAGGAGGTGAAATGAGGGAGG - Intronic
902005038 1:13225538-13225560 ATGGAGAAGAGACAGAAGGAGGG - Intergenic
902024264 1:13371332-13371354 ATGGAGAAGAGACAGAAGGAGGG - Intronic
902684204 1:18065199-18065221 AAGGAGAGGAGCACTAAGGAGGG + Intergenic
903331732 1:22600124-22600146 AAGGAGAGAAGGAAGGAGGAGGG + Intronic
903348734 1:22704754-22704776 ATGGAGAGAAGCAACCAGGAGGG - Intergenic
903571143 1:24306380-24306402 ATGGGGAAGAGAAAGAAGGATGG + Intergenic
903675803 1:25063815-25063837 AGGAAGAGGAGAAATGAGACAGG + Intergenic
903796604 1:25933656-25933678 AAGGAGAGGAGATATGTGGGAGG + Intergenic
903964326 1:27077028-27077050 AGGGAGGGGAGAAAAGAGGAGGG - Intergenic
904073081 1:27816944-27816966 AGAGAGAGGAGAAAGAAGGAAGG + Intronic
904406829 1:30296601-30296623 AAGGATAGGAAAAATGAGGCTGG + Intergenic
904480702 1:30791581-30791603 AGGGAGAGAAGGAAGGAGGAAGG + Intergenic
904577730 1:31516079-31516101 AAGGAAAGGAGAAAGGAGGAAGG - Intergenic
904807262 1:33140806-33140828 TTGGAGAGGACAACAGAGGAAGG + Intergenic
904974856 1:34448063-34448085 GGGGATAGGAGGAATGAGGATGG - Intergenic
905043496 1:34978616-34978638 ATGGAGAACAGAATAGAGGAAGG - Intergenic
905346408 1:37313971-37313993 GGGGAGAGGAGAGAGGAGGAAGG - Intergenic
905489441 1:38332098-38332120 AGGGAGAGGAGGAGTGAGGTTGG - Intergenic
905796923 1:40821028-40821050 CTGGGGAGGAGAGATAAGGAAGG - Intronic
905970282 1:42136710-42136732 AAGGAGGGGAGAAAAGAGGAAGG - Intergenic
906234715 1:44198844-44198866 ATGGAAAGGAGAAAAAAGAAAGG - Intergenic
906524886 1:46488273-46488295 AGGGAGAGGAGAGGAGAGGAGGG - Intergenic
906562023 1:46765314-46765336 ATGGAGAGAAGGAATGAAGAGGG - Intronic
906592093 1:47034813-47034835 ATGTGGCTGAGAAATGAGGAGGG - Intronic
906635896 1:47410338-47410360 AGGGCGGTGAGAAATGAGGAAGG + Intergenic
906680274 1:47721531-47721553 GTGGAGATGGGAAATGTGGATGG - Intergenic
906757094 1:48328588-48328610 GAGTGGAGGAGAAATGAGGAGGG + Intronic
906794804 1:48688352-48688374 ATGGAGATGAGGAAGCAGGAAGG - Intronic
906800373 1:48731955-48731977 ATGGAGGGGAGAAATGAGTGTGG + Intronic
906954180 1:50358854-50358876 ATGGAGAGGAGGGAAGAGCAGGG + Intergenic
907219576 1:52896420-52896442 CTGGAGAGGTGAAATGATGAAGG + Exonic
907468326 1:54654227-54654249 AGGGAGAGGAGAAGGAAGGAAGG + Intronic
907804616 1:57805895-57805917 ATTTAGAGGAGAAATAATGATGG - Intronic
907964412 1:59315386-59315408 AAGGAGAGGAGAAAAGAGAAGGG - Intronic
908216861 1:61962900-61962922 AAGGAAAGGAGAAAAGAGAAAGG + Intronic
908804031 1:67911194-67911216 AAGGAGAGGAGAAAGGAACATGG - Intergenic
908941901 1:69445343-69445365 ATCGAGAGTAGCAGTGAGGAAGG - Intergenic
909685110 1:78339294-78339316 ATGGGGAGGTGGGATGAGGAAGG - Intronic
910018452 1:82555600-82555622 AAGGAGAGGTGAACTGAGAAAGG - Intergenic
910087064 1:83416038-83416060 ATGCAGATGAGAGATGAGGAAGG + Intergenic
910089571 1:83446160-83446182 TTGCAGAGGAGAAATGAGAATGG + Intergenic
910279456 1:85482691-85482713 ATGGAGGGATGAAATGTGGATGG + Intronic
910371518 1:86521266-86521288 ATGAAGAGGAGATAACAGGAGGG + Intergenic
910384209 1:86664234-86664256 AAGGAGAGGAGCACTGAAGAAGG + Intergenic
910384446 1:86665686-86665708 AAGGAAAGGAGCACTGAGGAAGG - Intergenic
910474824 1:87595615-87595637 GGGGAGAGGAAAAAAGAGGAAGG - Intergenic
910698931 1:90051169-90051191 ATGCAGAGGAGGGATGAAGAAGG - Intergenic
911244415 1:95501030-95501052 ATGGAGAGGGTAAAGGAGAAAGG - Intergenic
911305515 1:96227222-96227244 TTGGAGGGCAGGAATGAGGAAGG - Intergenic
911325534 1:96467326-96467348 ATGGAGAGGGGAGAAGAGGGAGG + Intergenic
911346819 1:96706742-96706764 CTGGAGTGGAGGAGTGAGGAGGG + Intergenic
911782635 1:101902061-101902083 ATTGAAAGGTGAAAGGAGGAAGG + Intronic
911940914 1:104046491-104046513 ATGGAGAGCAGAAAAGAACATGG - Intergenic
912151201 1:106860773-106860795 AAGGAGAGGAGAGGAGAGGAGGG + Intergenic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
912168553 1:107069471-107069493 GAGGAAAGGAGAAAGGAGGAAGG + Intergenic
912516405 1:110219269-110219291 ATGGAGATAAGAGTTGAGGAGGG - Intronic
912642488 1:111360768-111360790 ATGCAGAGGGGAGATGGGGAAGG - Intergenic
912661052 1:111530921-111530943 AAGGAGAGGAGAAATAGGGATGG - Intronic
912699183 1:111863843-111863865 ATCCAGGGGAGAAATGATGAGGG + Intronic
912791353 1:112654771-112654793 ATGCAGAGGAGAAGAGAGCATGG - Intronic
913288111 1:117246098-117246120 GAGGAGAGGAGAAGTGAGGCAGG - Intergenic
914677921 1:149917931-149917953 GGGGAGAGGAGAAAAGAGGATGG + Intergenic
914915468 1:151816545-151816567 ATGGAGAGGAGACCAGAGGATGG + Intronic
914963161 1:152224855-152224877 ATGGAGGGGAGAAATGGAGCTGG - Intergenic
915736807 1:158090368-158090390 GGGGAGAGGAGAAAGGAGGGAGG - Intronic
915762371 1:158328212-158328234 TGGGAGAGGAGACATGATGATGG + Exonic
915894252 1:159799087-159799109 ATGGAGAGAGGGAATGAGGGTGG + Intergenic
915910791 1:159914030-159914052 ATGGAAAGGAGAGTTGGGGAAGG - Intergenic
916060454 1:161094901-161094923 ATGGAGAGGTGGAATAAGGATGG - Intergenic
916193080 1:162197937-162197959 ATGCAAAGGAGGTATGAGGAGGG + Intronic
916278373 1:163021036-163021058 ATGGAGACCAGAAAAGAGCAGGG - Intergenic
916400244 1:164439976-164439998 AAGGAGAGGAGAGGAGAGGAGGG + Intergenic
916473083 1:165142739-165142761 ATGAAGGAGAGAAAGGAGGAAGG - Intergenic
916912544 1:169366737-169366759 TTAGAAAGGAGAAATGAAGAGGG + Intronic
917157388 1:172019040-172019062 AGGGAGGGAAGAAAGGAGGAAGG - Intronic
917322046 1:173792803-173792825 ATGGAGAGGAGAAGTAAGAGTGG - Intergenic
917400371 1:174642665-174642687 AAGGAGAGGAGAGGAGAGGAGGG - Intronic
917503220 1:175604633-175604655 AAGGAGAGGAGGAGAGAGGATGG - Intronic
917534558 1:175864774-175864796 CTGCAGAGGTGAAATCAGGAGGG + Intergenic
917680296 1:177358945-177358967 ATGAAGGGGAGAAACAAGGAAGG + Intergenic
917685427 1:177411212-177411234 TTAGAGAGGAGAAATTAGCAAGG + Intergenic
917717666 1:177754391-177754413 GTGGAGAGGAGAAATGAAGAAGG + Intergenic
917721837 1:177792974-177792996 GTGGAGAGGGGACATGAGGGTGG + Intergenic
917749294 1:178039787-178039809 ATGGAGAGCAAAAATGAAGTAGG + Intergenic
917843782 1:179003609-179003631 ATGCCTAGGACAAATGAGGAAGG + Intergenic
917939363 1:179902598-179902620 ATTCATAGGAAAAATGAGGAAGG - Intronic
918102143 1:181385743-181385765 GAGGAGAGGAGGAAAGAGGAAGG - Intergenic
918149953 1:181789817-181789839 ATGGTGGTGAGAAAAGAGGATGG - Intronic
918813097 1:189146581-189146603 AGGAAGGGGAGAAAGGAGGATGG + Intergenic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919161803 1:193840171-193840193 AGAGAGAGGAGAGATGGGGAAGG + Intergenic
919750934 1:201037775-201037797 CTAGAGAGGAGAAATGAGAATGG + Intergenic
919884233 1:201921112-201921134 ATGGAGCGGGGAGATGAGGGTGG + Intronic
919930977 1:202221456-202221478 ATGGAGAGGAGAGAAGAGAGGGG - Intronic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920170743 1:204071104-204071126 ATGGAAAGGAGAAAACAGGTGGG - Intergenic
920189222 1:204181775-204181797 AAGGAGAAGAGAAAAGAGGAAGG - Intergenic
920535927 1:206736540-206736562 GAGGAGAGGAGATATGAGGCTGG + Intergenic
920791553 1:209097642-209097664 AGGCAGAAGAGAAAAGAGGAAGG - Intergenic
921131838 1:212226396-212226418 ATGGAGAGAGGAAGTGGGGAAGG - Intergenic
921353035 1:214256939-214256961 ATGGAGTGGAGGACTGAGAAGGG + Intergenic
921622722 1:217343934-217343956 AAGGAGATGAGAAAAGAGCAAGG + Intergenic
921637891 1:217518732-217518754 AGGGAGAGAAGAAAGGATGATGG - Intronic
921747772 1:218756932-218756954 ATGGGGATGTGAAATGAGGATGG + Intergenic
921756640 1:218864588-218864610 AAGGAGAGAAGAAAGGAGGGAGG - Intergenic
922426011 1:225494162-225494184 GTGGAGAGGAGAATGGAGGGGGG + Exonic
922501050 1:226097155-226097177 GTGCAGTGGAGAAAAGAGGATGG + Intergenic
922607923 1:226902440-226902462 ATGGAGAGAAGAGAGGAGGTAGG + Intronic
922934244 1:229411381-229411403 TAGGAGAGGAGAGAGGAGGAGGG - Intergenic
923127776 1:231047368-231047390 AAGGAAAGGAGAGAGGAGGAAGG - Intergenic
923127794 1:231047441-231047463 AAGGAAAGGAGAGAGGAGGAAGG - Intergenic
923127812 1:231047514-231047536 AAGGAAAGGAGAGAGGAGGAAGG - Intergenic
923127830 1:231047587-231047609 AAGGAAAGGAGAGAGGAGGAAGG - Intergenic
923227371 1:231950822-231950844 AAGGAAAGGAGAAATGAGTAAGG - Intronic
923250308 1:232174385-232174407 ATGAAGGGGAGACCTGAGGAAGG + Intergenic
923453042 1:234137680-234137702 GTGGAGAGGAGAACCGAAGATGG + Intronic
923897489 1:238288299-238288321 ATGAAGAGGAGATAAGAGGATGG - Intergenic
923927983 1:238657902-238657924 GTGGATAGGAGGAAAGAGGAGGG + Intergenic
924021199 1:239785543-239785565 ATGGAGAGGAAGACTGACGAGGG - Intronic
924121569 1:240804910-240804932 ATAGAGAGTGGAAATAAGGAAGG + Intronic
924247653 1:242100518-242100540 ATGGAGATGAGGAAACAGGACGG - Intronic
924454053 1:244203876-244203898 AGGGAAAGAAGAAATGAGGAAGG - Intergenic
924575603 1:245277994-245278016 ATGGAGGGAAAAAATTAGGAAGG + Intronic
924628755 1:245717119-245717141 AGGGAGGAGAGAAAAGAGGAGGG + Intergenic
924628773 1:245717193-245717215 ATAGGGAGGAAAAAGGAGGATGG + Intergenic
1062773400 10:123639-123661 ATGGAGGGAAGGAAGGAGGAAGG + Intergenic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063541735 10:6941056-6941078 TTAGAGAGGAGGAATCAGGAAGG - Intergenic
1063911648 10:10836212-10836234 AAGAAAAGGAGAAAGGAGGAGGG + Intergenic
1063936302 10:11082105-11082127 GTGGAGGGCAGGAATGAGGAAGG + Intronic
1063953599 10:11246468-11246490 AAGTAGAGGGGAAAGGAGGAGGG - Intronic
1063953947 10:11248417-11248439 ATGGAGAGGAGGAGGGTGGAAGG - Intronic
1064228669 10:13509687-13509709 TTGGGGAGGAGAAAAGAGAACGG + Intronic
1064319941 10:14295625-14295647 ATGGTGAGAGGAGATGAGGAGGG + Intronic
1064755828 10:18571243-18571265 ATGGAAAGGAGAATGGAGAATGG - Intronic
1064756120 10:18573040-18573062 ATGGAGAAGAGAATGGAGAATGG - Intronic
1065495137 10:26319801-26319823 ATGGGGACCAGAAGTGAGGAGGG + Intergenic
1065695045 10:28371972-28371994 AGAGAGAGGAGAAATGAGGAGGG + Intergenic
1066277659 10:33884722-33884744 ATGGAGAAGAGAGAAGTGGATGG - Intergenic
1067167559 10:43877866-43877888 AAGGAGTGGAGAAGAGAGGACGG - Intergenic
1067390735 10:45860813-45860835 ATAAAGAGGAGAAAAGAGAAAGG + Intergenic
1067398847 10:45951810-45951832 ATGGGGTGGAGAAAGAAGGACGG + Intergenic
1067434998 10:46270414-46270436 ACTCAGAGGGGAAATGAGGAAGG + Intergenic
1067488897 10:46679238-46679260 GTGGAAAGGAGGGATGAGGAAGG - Intergenic
1067500736 10:46803036-46803058 ATAAAGAGGAGAAAAGAGAAAGG - Intergenic
1067593847 10:47536864-47536886 ATAAAGAGGAGAAAAGAGAAAGG + Intronic
1067605771 10:47661138-47661160 GTGGAAAGGAGGGATGAGGAAGG + Intergenic
1067640958 10:48044977-48044999 ATAAAGAGGAGAAAAGAGAAAGG + Intergenic
1067712520 10:48661350-48661372 ATGGAGAGGAGAAACAAGCTTGG - Intergenic
1067867168 10:49921046-49921068 ATGGGGTGGAGAAAGAAGGACGG + Intronic
1067872544 10:49975290-49975312 ATAAAGAGGAGAAAAGAGAAAGG - Intergenic
1067914655 10:50384406-50384428 AGGGAAAGGAGAAAGAAGGAAGG - Intronic
1068410147 10:56644412-56644434 ATGGAAAGGAGAAAAAAGCAGGG - Intergenic
1068534027 10:58220215-58220237 AGGCAGAGGAGAGAAGAGGAAGG + Intronic
1069312276 10:67052656-67052678 AGGATGAGGAGAAAGGAGGAGGG + Intronic
1069332160 10:67305459-67305481 ATGTAGGGGAGAAATAAAGAAGG + Intronic
1069449214 10:68502737-68502759 AAGGAGAGGAGAGGAGAGGAGGG + Intronic
1069668725 10:70183528-70183550 AAGGAAAGGAGAAAAGAGAAAGG + Intergenic
1070137922 10:73711031-73711053 ATAAAGAGGAGAAAAGAGAAAGG + Intergenic
1070421722 10:76243989-76244011 ATGGAGAAGAGATATGAAGATGG + Intronic
1071194205 10:83138579-83138601 ATGGAGAGGAGAACTGGGCTGGG - Intergenic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071621330 10:87122497-87122519 GTGGAAAGGAGGGATGAGGAAGG + Intronic
1071793297 10:88979213-88979235 CTGGGGAGGAGAGATAAGGAAGG + Intronic
1071807737 10:89142760-89142782 AAGGAGAAGAGAAAGGAGAAGGG + Intergenic
1071930372 10:90463066-90463088 ATCTAGGGGAGAAATGATGATGG + Intergenic
1072413047 10:95222686-95222708 GTGGAGAGGAGAAAACAGGAAGG + Intronic
1072508253 10:96091758-96091780 ATAGAAAGGAAAAATGAGAAGGG + Intergenic
1072839982 10:98762009-98762031 AAGGAGAGGAGAAGAGGGGAGGG - Intronic
1073041732 10:100612497-100612519 ATGGAGAGTGGAAAAGAGGGGGG - Intergenic
1073048671 10:100654421-100654443 AGGGAGAGGAGGAAGGAGGGAGG - Intergenic
1073144596 10:101272293-101272315 ATGAAGAGGACACATGAGTAGGG + Intergenic
1073339709 10:102735504-102735526 AGGGAGAGGAGAAACTTGGAGGG - Intronic
1073348413 10:102801879-102801901 AGGGAGGGGAGAGAGGAGGAGGG - Intronic
1073459502 10:103658541-103658563 GTGGAGGGGAGAAAGGAAGAGGG - Intronic
1073671178 10:105591808-105591830 AGGGTGAGGAGGAAGGAGGAGGG + Intergenic
1074081264 10:110169836-110169858 AGGGAGAAGGGAGATGAGGAGGG - Intergenic
1074145935 10:110717344-110717366 CTGGAGAGGAGGGAGGAGGAGGG - Intronic
1074440962 10:113477046-113477068 AAGGGCAGGAGAAATGAGGGTGG - Intergenic
1074544619 10:114393072-114393094 AAGGAGAGGAGGAAGCAGGAAGG + Intronic
1074722514 10:116274490-116274512 AAGAAGAGGAGGAAGGAGGAGGG + Intergenic
1074885907 10:117693497-117693519 ATGGGGAGGAGATAGGATGATGG + Intergenic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1075330937 10:121573614-121573636 AGGGAGAGGAAAGAAGAGGAAGG + Intronic
1075479478 10:122767761-122767783 TTGCAGAGGAGAAATCAGGCAGG + Intergenic
1075838605 10:125477672-125477694 AGGGAGAGGAGGAAAGAAGAAGG + Intergenic
1076077005 10:127541795-127541817 ATGGAGGGTAGAAATGGGAACGG - Intergenic
1076289228 10:129331612-129331634 AATGAGAGGAGAAGGGAGGAAGG + Intergenic
1076523320 10:131094669-131094691 AGGGAGAGAAGGAAGGAGGAAGG - Intronic
1077095256 11:796368-796390 CTTGAGAGGAGAGATGAGCAGGG + Intronic
1077600792 11:3573114-3573136 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1077772515 11:5235513-5235535 GAGGAGAGGAGAAAAAAGGAGGG + Intergenic
1077841158 11:5976156-5976178 AGGGAGAGAAGGAAGGAGGATGG + Intergenic
1078105254 11:8354308-8354330 AGGATGAGGAGGAATGAGGAAGG - Intergenic
1078390434 11:10931638-10931660 AAGGAGAGAAGAAAAGAGGCAGG + Intergenic
1078658484 11:13264399-13264421 ATGGAGAAGAGAAAACAGTAGGG + Intergenic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1078763597 11:14272382-14272404 ATGGAGAGGAGAGAAGAGTGAGG - Intergenic
1079055921 11:17207060-17207082 ATTGAGGAGGGAAATGAGGAAGG - Intronic
1079189282 11:18264690-18264712 GAGGAGAGGAGAAGAGAGGAGGG + Intergenic
1079835515 11:25328396-25328418 AGGAAGAGGAGAAATCAGGCTGG + Intergenic
1080087420 11:28301255-28301277 AGGGAGATGAGAGAAGAGGAAGG - Intronic
1080132517 11:28813689-28813711 ATGGATAGGGGCAGTGAGGAGGG - Intergenic
1080930412 11:36804362-36804384 AGAGAGAGAAGAAATGAAGAAGG - Intergenic
1081021175 11:37949191-37949213 ATGGACAGCAGATATAAGGAAGG + Intergenic
1081734806 11:45395222-45395244 AGGAAGAGGAGAAAGGTGGAAGG - Intergenic
1082757051 11:57087728-57087750 AGGGAGAGCAGAAAGCAGGAGGG + Intergenic
1082788394 11:57330347-57330369 TTGGAGAGGATGAAGGAGGAAGG - Exonic
1082892401 11:58154095-58154117 AAGGGGAGGAGGAAGGAGGAGGG + Intronic
1083121601 11:60518672-60518694 ATTGTTAGAAGAAATGAGGAAGG + Intronic
1083535616 11:63464164-63464186 ATGCAGAGCAGAGAGGAGGAAGG + Intronic
1083588549 11:63878254-63878276 ATGGAGATGAGGAATGAGGCTGG - Intronic
1083996574 11:66276015-66276037 AGGGAGAGGAGAGAAGAGGAGGG - Intronic
1084021776 11:66422055-66422077 AGGCAGAGAAGAAGTGAGGAAGG - Intronic
1084234161 11:67775601-67775623 CTCCAGAGTAGAAATGAGGAAGG + Intergenic
1084256712 11:67947699-67947721 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1084694288 11:70744537-70744559 TTGGAAAGGAGCAAGGAGGAGGG - Intronic
1084816078 11:71647675-71647697 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1084837966 11:71818445-71818467 ATGGAGATGAGATATCAGGCAGG + Intergenic
1085249383 11:75132217-75132239 AAGGAAAGGAGAAAGAAGGAAGG + Intronic
1085624577 11:78062127-78062149 CAGGAGAGGAGAGAGGAGGAGGG - Intronic
1085753961 11:79188647-79188669 AAGCAGAAGAGAAGTGAGGATGG + Intronic
1085806301 11:79639909-79639931 ATGGAGGGGAGAAATGTTCATGG - Intergenic
1085887364 11:80536251-80536273 ATGTAGAGGAGAAGTGTGGCAGG - Intergenic
1086276882 11:85140707-85140729 ATGGAGGGGAAAAGTGGGGATGG - Intronic
1086348603 11:85922731-85922753 ATGGAGAAGAGTGATGAGAAGGG - Intergenic
1086493414 11:87378054-87378076 ATGGAGAGGAGAGCTGGAGAGGG + Intergenic
1087717499 11:101625421-101625443 AGGGAGAGGTGAAAAGAGGAAGG - Intronic
1087896204 11:103589662-103589684 ATGGACAGGAGACAGGAGGGTGG + Intergenic
1087968402 11:104448773-104448795 AAGGAGAGGAAAAAGGAAGATGG + Intergenic
1088214719 11:107495015-107495037 ATGGAGTGGAGACTTGAAGATGG - Intergenic
1088544925 11:110949768-110949790 ATGGAGAGGTGCAATAAAGAAGG + Intergenic
1088602545 11:111494132-111494154 ATGGAGATGAGAGAGGAGAAGGG + Intronic
1088622024 11:111694811-111694833 AAGGGGAAGAGAAATGAAGAGGG - Intronic
1088630620 11:111770818-111770840 GTGGAGAGGAGACCTGAGGGAGG - Intergenic
1088649149 11:111942128-111942150 GGGGAGAGGAGAAATCAGGCAGG - Intronic
1088741787 11:112773560-112773582 GAGGAGAGGAGAGATGAGGCTGG + Intergenic
1089225559 11:116917787-116917809 AAGGAGAGGACAAGAGAGGAAGG + Intronic
1089304549 11:117518212-117518234 CTGGACAGGAGGAAGGAGGAGGG + Intronic
1089391476 11:118104853-118104875 AGGAAGAGGAGGAAGGAGGAAGG - Intronic
1089612535 11:119677485-119677507 AAGGAGAGGAGGAGGGAGGAGGG + Intronic
1089637902 11:119828095-119828117 GCAGAGAGGAGAAGTGAGGACGG + Intergenic
1089739350 11:120571675-120571697 AAGAAGAGGAGAGATGAGGGGGG - Intronic
1089753536 11:120669030-120669052 ATTTGGTGGAGAAATGAGGAAGG - Intronic
1090139501 11:124239844-124239866 ATGGAAAGAATAAATGAGGTTGG - Intergenic
1090510632 11:127371065-127371087 ATGGAGAAGAGAGATGAGAAAGG - Intergenic
1091112417 11:132982197-132982219 AAGGAGAGGAGAAAGAAGCAGGG - Intronic
1091197662 11:133745821-133745843 ATGGGGAGGAGAGAAAAGGAGGG - Intergenic
1091524999 12:1290932-1290954 ATGCAGAGAAGAAGTGAGCAAGG - Intronic
1092299727 12:7235265-7235287 GTGGGGAGGAGAAAACAGGAAGG + Intergenic
1092400739 12:8175628-8175650 ATGGAGATGAGATATCAGGCAGG - Intronic
1092426926 12:8382372-8382394 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1092449983 12:8593233-8593255 AAGGAGAGGAGAGGAGAGGATGG + Intergenic
1092484506 12:8890868-8890890 ACTGAGAGAAGAAATGTGGAAGG - Intergenic
1092966195 12:13645780-13645802 TTGGACAGGAGAAATGCTGAAGG - Intronic
1093073975 12:14737983-14738005 ATGTGGAGCAGAACTGAGGAGGG - Intergenic
1093188729 12:16050963-16050985 CTAGAGAGGATAATTGAGGAAGG + Intergenic
1093734592 12:22606239-22606261 AAGGAGAGAAGGAAGGAGGAAGG - Intergenic
1094020100 12:25904834-25904856 AAGGAGTGGAGGAATCAGGAAGG - Intergenic
1094406001 12:30116795-30116817 ATGGAAAGGAGACATGAGTTGGG - Intergenic
1094464413 12:30736789-30736811 CTTGAGAGAAGAAAAGAGGACGG + Intronic
1094635572 12:32224212-32224234 ATGGAGAGGAGAAGAGAGACAGG - Intronic
1095743361 12:45630900-45630922 AGGTAGAGGAGAAAGGAGAAAGG + Intergenic
1095991204 12:48035801-48035823 AGTGATAGGAGGAATGAGGAAGG - Intergenic
1096328400 12:50687014-50687036 AGAGAACGGAGAAATGAGGAGGG + Intronic
1096576248 12:52554609-52554631 ATGGATGGGAGGGATGAGGAGGG - Intergenic
1096646664 12:53041944-53041966 AAGGAGAGTAGACATGAAGAGGG - Exonic
1096824310 12:54263062-54263084 ATTGAGATGAGAAAAGAGGCTGG + Intronic
1096870560 12:54589687-54589709 GTGGAGAGAAGAACTGGGGATGG + Intergenic
1096981852 12:55732662-55732684 AGGGTGAGGGGATATGAGGAGGG + Intergenic
1096981857 12:55732681-55732703 AGGGTGAGGGGATATGAGGAAGG + Intergenic
1097332261 12:58344264-58344286 AAGAAGAGGAGAGATGAAGAAGG + Intergenic
1097332874 12:58351418-58351440 GTGGAGAGGAGAGGAGAGGATGG + Intergenic
1097350598 12:58544448-58544470 ACAGAGAGGAGAAAGGAAGAAGG - Intronic
1098017834 12:66125182-66125204 ATGTAGAAGATAAATGAGAAGGG + Intronic
1098056733 12:66514555-66514577 ATGGAGAGAAGAAAGGAGAGAGG + Intronic
1098709179 12:73733167-73733189 GAGGAGGGGAGAAATGGGGATGG + Intergenic
1098862275 12:75723519-75723541 ATGGAGGGTAGAAGTGAGGAAGG - Intergenic
1099113296 12:78590010-78590032 ATTGAGAGAAGAAAAAAGGAAGG + Intergenic
1099173503 12:79393878-79393900 ATGGAGTGGGGAAAAGAAGAGGG - Intronic
1099174958 12:79410433-79410455 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1099248780 12:80226520-80226542 ATGGGAAGGAAAACTGAGGAAGG - Intronic
1099304668 12:80938111-80938133 ATGGAAAGGGGATATGGGGAAGG + Intronic
1099578151 12:84406024-84406046 ATGGTGAAGAGATATGTGGATGG + Intergenic
1099951368 12:89308126-89308148 AGAGTGAGGAGAAATGAGGCTGG + Intergenic
1100006264 12:89899374-89899396 GTGGGCAGGGGAAATGAGGAAGG - Intergenic
1100042468 12:90336977-90336999 AGGAAGAGAGGAAATGAGGAAGG - Intergenic
1100223277 12:92530296-92530318 ATGGACAGGGGAAATGGGGTTGG - Intergenic
1100763801 12:97840145-97840167 ATGGAAAGAAGAAAACAGGAGGG - Intergenic
1101070331 12:101068119-101068141 ATGGCCAGAAGAAATAAGGAAGG + Intronic
1101302883 12:103499516-103499538 ATGGAGAAGAGAAAGGAAGATGG + Intergenic
1101500076 12:105295592-105295614 AAGCAGAGAAGAAATGATGAGGG - Intronic
1101909407 12:108850493-108850515 ATGGGGAGGAGAAATGGGAGAGG + Intronic
1102016901 12:109654216-109654238 AGAGAGGGGAGGAATGAGGAGGG - Intergenic
1102152243 12:110696915-110696937 GTGTAGAGGAGAGATAAGGATGG + Intronic
1102544155 12:113642638-113642660 ATGGAGGGGAGAAGGAAGGAAGG - Intergenic
1102553597 12:113711023-113711045 ATGGAGGTAAGAAAGGAGGAAGG - Intergenic
1102627442 12:114246805-114246827 ATTGAGAGCAGAAGGGAGGAAGG - Intergenic
1102746988 12:115258064-115258086 ATGGAGAGGAAAAATGGGGAAGG - Intergenic
1102767096 12:115443046-115443068 ATGGAGAGGAAAAAGGAACAGGG - Intergenic
1103759857 12:123241060-123241082 TTGGAGAGAAGTAAAGAGGATGG - Intronic
1104371866 12:128230598-128230620 ATGAAGAGAAGAAATGAAAAGGG - Intergenic
1104435316 12:128751436-128751458 TGGGAGAGGGGAAATGGGGAAGG + Intergenic
1104463316 12:128971715-128971737 ATGGAGGGGGGAAGGGAGGAGGG - Intronic
1104485241 12:129145876-129145898 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1104559651 12:129832257-129832279 AAGGAGAGGAAAAAGGGGGAGGG + Intronic
1104606124 12:130189696-130189718 AAAGAGAAGAGTAATGAGGAGGG - Intergenic
1104655645 12:130572133-130572155 ATGGCCAGGAGTTATGAGGAAGG + Intronic
1104676012 12:130713040-130713062 AGGGAGAGGAGGAATGAGGGAGG + Intronic
1104827477 12:131723621-131723643 ATGAAGAGGGGAAATTAGCAAGG - Intronic
1105273980 13:18904210-18904232 CGGGAGAGGGGAAAAGAGGATGG - Intergenic
1105348638 13:19596867-19596889 ATGGAGTGGAGAAATATGGAAGG + Intergenic
1105764591 13:23546922-23546944 ATGGAGGGGAGAGAGGAGGGAGG - Intergenic
1105892723 13:24693355-24693377 ATGGAGAGGAAAAGGGAGGAAGG - Intronic
1105965500 13:25380204-25380226 AGGGAGATGAGAGATGAGGGAGG + Intronic
1105972028 13:25438143-25438165 GGGCAGATGAGAAATGAGGAAGG + Intronic
1106288064 13:28335404-28335426 AGGGAGTGGAGTAATGAGGAAGG - Intronic
1106307729 13:28528223-28528245 ATAGAGCGGGGAAATGGGGAGGG + Intergenic
1106425731 13:29627086-29627108 ATGGAAAGCAGAAAAAAGGAGGG + Intergenic
1106603535 13:31207808-31207830 GTGGAGAGAAGTAGTGAGGAAGG - Intronic
1106798662 13:33233485-33233507 GTGGAGAGGAGAACTGGAGAAGG - Intronic
1107220909 13:37978824-37978846 GAGGAGAGGAGAAAGGAGAAAGG + Intergenic
1107333087 13:39322696-39322718 AGGGAGAGAAGGAAGGAGGAAGG + Intergenic
1107453730 13:40535779-40535801 CTGGAGAGGAGCAGTAAGGAAGG - Intergenic
1107481027 13:40786458-40786480 ATGGAGAGGAGAAATGTGGAAGG + Intergenic
1107571442 13:41663306-41663328 ATGGAAAAGAGGAATGAGGGTGG - Intronic
1107659185 13:42621750-42621772 AAGCAGAAGAGAAAGGAGGAAGG + Intergenic
1107732746 13:43365105-43365127 AAAGAGAGAAGAAGTGAGGAAGG - Intronic
1107923057 13:45229801-45229823 GGGGAGAGGAGAAAAGAGGAGGG - Intronic
1108071570 13:46634367-46634389 ATCCAGGTGAGAAATGAGGAAGG - Intronic
1108283353 13:48881448-48881470 CTGGAGAAGAGAAAGGAGAATGG + Intergenic
1108304042 13:49113107-49113129 AGGGAGAGGAGAAAACAGAAGGG - Intronic
1108462683 13:50682898-50682920 AGGGAGAGGGGAAGTGAGGTGGG - Intronic
1108523817 13:51268283-51268305 ATGGAAAGGAGTAATGAGAACGG + Intronic
1108623760 13:52208320-52208342 GTAGAGAGGAGAAATGTGGAAGG + Intergenic
1108662956 13:52602711-52602733 GTAGAGAGGAGAAATGTGGAAGG - Intergenic
1108722358 13:53145347-53145369 GAGGAGAGGAGAAGGGAGGAGGG - Intergenic
1109020336 13:57083013-57083035 ATGGACGGGACAAAAGAGGAGGG - Intergenic
1109729233 13:66389008-66389030 ATGGACAGAAGAAATGAGATTGG - Intronic
1109805894 13:67442447-67442469 ATGGGGAGGGGAAATAAAGAGGG - Intergenic
1109971725 13:69779344-69779366 AAGGAAAGGAAAAAAGAGGAGGG - Intronic
1110268643 13:73568371-73568393 ATGGAGAGAAGAGATGAAGAAGG - Intergenic
1110329331 13:74252761-74252783 ATGGGGAAGAGAAGGGAGGATGG - Intergenic
1110333053 13:74294807-74294829 TTGCAGGGGAAAAATGAGGAAGG - Intergenic
1110486614 13:76051955-76051977 GTGTAGAGGAGAAAAGAGGATGG - Intergenic
1110513775 13:76384436-76384458 AGGGATAGGAGAGATAAGGAGGG + Intergenic
1110873992 13:80487257-80487279 CTGGAGAAGATAAATGTGGATGG + Intergenic
1111086438 13:83380751-83380773 AGGGAGAGGAGAAGGAAGGAAGG - Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111537413 13:89621162-89621184 ATGGAGAGGAAAGAAGAGAAAGG - Intergenic
1111698282 13:91653391-91653413 GTGTAGAGGGGAGATGAGGATGG + Intronic
1111904253 13:94237299-94237321 ATGGAGAAAAGAAAGAAGGAAGG - Intronic
1112177965 13:97047294-97047316 ATGAGGAGAAGGAATGAGGAGGG - Intergenic
1112353459 13:98655386-98655408 ATGGAGAGGGGAAGTGCGCAGGG - Intergenic
1112441223 13:99426387-99426409 AGGGAGTGGAGGAATGAGGGGGG - Intergenic
1112674148 13:101678862-101678884 TTGGGGAGGAGAAAGGAGTAGGG - Intronic
1113159584 13:107364945-107364967 AGGGAGAGAGAAAATGAGGAGGG - Intronic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113184012 13:107665567-107665589 ATTGAGAGCAGAAATGGAGAGGG - Intronic
1113771126 13:112909608-112909630 ATGGAAACAAGAAATGAAGAGGG + Intronic
1113905389 13:113817202-113817224 CTGGAGAGGAGGAAGGAGGTTGG - Intergenic
1113909847 13:113836632-113836654 GAGGAGAGGGGAAATAAGGATGG + Intronic
1114393422 14:22334785-22334807 CAGGAAAGGAGAAATGAGGGAGG + Intergenic
1114492189 14:23109999-23110021 ATGAAGATGAGGAAGGAGGAAGG + Intergenic
1114537496 14:23432292-23432314 ATGGAAAGCAGAAAGGAAGAGGG + Intronic
1115053064 14:29088720-29088742 GTGGAGAGGGGAAATGGGGATGG + Intergenic
1115364145 14:32537468-32537490 ATGGAGATCAGAGATGAGGAAGG + Intronic
1115498184 14:34027232-34027254 AGGGGGAGGAGAGAGGAGGAGGG + Intronic
1116660490 14:47704464-47704486 ATTCAGGGGAGAAAAGAGGATGG + Intergenic
1116759519 14:48993857-48993879 GTAGAGAGGAGACATGAGAAGGG + Intergenic
1116787881 14:49308041-49308063 AGGGAGGGGAGAAATGTCGAAGG - Intergenic
1116827150 14:49683701-49683723 AAGGAAAGGAAAAATGAGGCAGG + Intronic
1116967771 14:51031946-51031968 GTGGAGGGCAGAAAGGAGGAGGG + Intronic
1117243947 14:53864719-53864741 ATTCAGATGAGAAATGATGATGG + Intergenic
1117265340 14:54080486-54080508 ATGGGGAAGAGAAATATGGATGG - Intergenic
1117390357 14:55256544-55256566 ATGGAGAGCTGGAAAGAGGATGG - Intergenic
1117810936 14:59546318-59546340 ATGGAGGGAAGAAGTGGGGAAGG + Intronic
1118139447 14:63064443-63064465 AAGGAGAGGAGAGTAGAGGAGGG + Intronic
1118346232 14:64943047-64943069 ATGGAGAGGAAAAAAAGGGAGGG + Intronic
1118663119 14:68037078-68037100 AGGGAAAGGAGAAAGGAGAAAGG - Intronic
1118723843 14:68612844-68612866 AGGGAGAGGGGAAGGGAGGAAGG + Intronic
1119084867 14:71730431-71730453 AGAGAGAGGGCAAATGAGGAAGG - Intronic
1119193121 14:72697764-72697786 ATGGAGAGGAAAAATGGGGTGGG + Intronic
1119887694 14:78157171-78157193 ATGGAGAGGAGGAAGTAGGAGGG + Intergenic
1120048829 14:79841338-79841360 ATAGAGAGGAGAAAACAGGTTGG + Intronic
1120091527 14:80337700-80337722 AGAGAGAGGAAAAAGGAGGAAGG + Intronic
1120519310 14:85508202-85508224 AAGGAAAGGAGAAAGGAGGACGG + Intergenic
1120717439 14:87854980-87855002 AAGGACAGGAGGAATGGGGAAGG + Intronic
1120815675 14:88855274-88855296 AAGGAGATGAAAAATGAAGAAGG - Intronic
1120988539 14:90354976-90354998 ATGGGGAGGGGAAAGGAGGAGGG + Intergenic
1120999991 14:90444662-90444684 ACAGAAAGGAGAAAGGAGGAGGG - Intergenic
1121206419 14:92172333-92172355 ATTGAGAGGAGAAATGGGTACGG + Intergenic
1121343265 14:93117216-93117238 ATGGAGAGTGGAAAAGACGATGG + Intergenic
1121382232 14:93482787-93482809 ATGGAGAGCAGAAGGTAGGAGGG - Intronic
1121425920 14:93852037-93852059 GTGGAGAGAAGAGATGGGGAGGG - Intergenic
1121586959 14:95069118-95069140 GAGGAGAGGAGAGCTGAGGACGG + Intergenic
1121780459 14:96618840-96618862 ATAGACAGGAGGAAGGAGGAGGG - Intergenic
1121832706 14:97065890-97065912 ATGGAGGGGCCAAATTAGGATGG + Intergenic
1122002119 14:98667136-98667158 AAGGAGAGAGGAAAGGAGGAAGG - Intergenic
1122091608 14:99344391-99344413 ATGGCGAGGAGAAGGGAGAAGGG + Intergenic
1122254193 14:100464676-100464698 ATGGGGAGGGGAGATGAGGTAGG - Intronic
1122417307 14:101556603-101556625 ATGCAGACGAGACCTGAGGAAGG + Intergenic
1122801273 14:104230824-104230846 ATGGAGATGAGGCCTGAGGAGGG + Intergenic
1123058823 14:105585307-105585329 ATGGAGGGGTGAATGGAGGATGG - Intergenic
1123083150 14:105705533-105705555 ATGGAGGGGTGAATGGAGGATGG - Intergenic
1123955060 15:25326523-25326545 ATCTTGAGGAGAGATGAGGATGG + Intergenic
1123968847 15:25485466-25485488 ATGAAGAGGAGAAAAGAGAGTGG - Intergenic
1124109948 15:26775773-26775795 AGGGAGCTGAGAAAGGAGGAAGG - Intronic
1124372303 15:29110708-29110730 AGGGGGAGAAGAGATGAGGAAGG + Intronic
1124656417 15:31512662-31512684 ATGCAGAGGAGAATAAAGGAAGG + Intronic
1125113602 15:36062895-36062917 ATGGAGAGGGGAGACAAGGAAGG - Intergenic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1125792046 15:42374335-42374357 AGGGACAGGAGAAATGGAGAGGG + Intronic
1125826768 15:42683058-42683080 ATGGAGAAAAGAAACAAGGAAGG - Intronic
1126059189 15:44762453-44762475 AAGGAGAGGAGAAAAGGGGTTGG - Intronic
1126320327 15:47415522-47415544 AAGGAGAGGAGAAAGGAGACGGG - Intronic
1126324022 15:47455661-47455683 ATGGTGGTGAGAAATGTGGAAGG - Intronic
1126682374 15:51214763-51214785 CTGGAGAGGGGAGATGAGGCTGG + Intronic
1126841762 15:52724305-52724327 ATGGAGCGGAGAAGTTGGGATGG - Intergenic
1126975762 15:54178278-54178300 GTGGAGAGAAGATATGGGGAGGG - Intronic
1127189990 15:56519145-56519167 AAGGAAAGGAGAAAGGAGAAAGG + Intergenic
1127524221 15:59776127-59776149 CTGGAGAAGAGAAATGAGCTGGG - Intergenic
1127663898 15:61125707-61125729 ACTGGGAGGAGAAAAGAGGAAGG - Intronic
1127691117 15:61398660-61398682 AGGGAGAGGGGAAAGGTGGAGGG + Intergenic
1128031881 15:64488287-64488309 ATGGAGAGGAGAAATGCCAGCGG + Intronic
1128224040 15:65989365-65989387 CTGGAGAGGAGAAGGGAGGTGGG - Intronic
1128252239 15:66171526-66171548 ATGGAGAGGTGGGAGGAGGAGGG + Intronic
1128747346 15:70123824-70123846 ATGGAGAGGCAAGATGGGGACGG + Intergenic
1128920280 15:71603931-71603953 ATGGAGAGAAGAACTGAATATGG + Intronic
1129124245 15:73424291-73424313 ATGGTGAGGAGAAATGCTTATGG + Intergenic
1129405555 15:75314845-75314867 AGGGAGGGGAGAGAAGAGGAGGG + Intergenic
1129518890 15:76173278-76173300 TTGGAGAGAGGAAATGTGGAGGG + Intronic
1129800171 15:78407821-78407843 GTGGTGCTGAGAAATGAGGAAGG - Intergenic
1129929855 15:79401738-79401760 ATGGAAAAGAGAAACGAGGGTGG + Intronic
1129977749 15:79836638-79836660 AGGGTGGGGAGAAATGGGGATGG + Intronic
1129978594 15:79845928-79845950 AATGGGAGGGGAAATGAGGAGGG - Intronic
1130072691 15:80661808-80661830 ATGGAGAGTAGAAAGAAGGGTGG - Intergenic
1130162634 15:81416402-81416424 AGGGAGAGGAGAAATGTGGTAGG - Intergenic
1130197314 15:81792711-81792733 ATGGATTTGAGAAATGAGGAGGG + Intergenic
1130373360 15:83306084-83306106 CTGGAGAGGAGAAGTGGGGGCGG + Intergenic
1130721201 15:86387051-86387073 ATGGAAAGCAGAAAGGGGGATGG + Intronic
1130789481 15:87137544-87137566 ATGGAAAAGAGTAAAGAGGATGG + Intergenic
1131880713 15:96859299-96859321 AGGGAGGGGAGAAATGGGGAAGG - Intergenic
1132091173 15:98949003-98949025 ATGGAGAGGATGAGTAAGGATGG - Intronic
1132127154 15:99237873-99237895 TTGAAGAGGAGGAATGGGGAGGG - Intronic
1132425041 15:101709106-101709128 CAGCAGAGGAGAAATGAGGCAGG - Intronic
1132427301 15:101728992-101729014 ATTGAAAGGAGAAATGAAAAAGG + Intergenic
1132799058 16:1742570-1742592 ATGAACAGGAGTAATGAGGATGG + Intronic
1133339488 16:5027382-5027404 ATGGAAAGGAGATGGGAGGAGGG + Intronic
1133366816 16:5216754-5216776 GAGCAGAGAAGAAATGAGGAGGG - Intergenic
1133371335 16:5247992-5248014 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1133417382 16:5616877-5616899 AGGCAGGGGAGAAAGGAGGAAGG - Intergenic
1133517280 16:6521529-6521551 AAGGAGAGGAGAGGAGAGGAAGG - Intronic
1133523667 16:6582938-6582960 AAGGAAAGGAGAAAAGAGGAGGG - Intronic
1133709813 16:8390510-8390532 ATGGAGAGGAGATTGTAGGATGG - Intergenic
1134297570 16:12960772-12960794 TTGGAGAGGAGGGAAGAGGACGG - Intronic
1134416150 16:14045042-14045064 ATGGTGACGAGAAATGAGACAGG - Intergenic
1134710889 16:16326517-16326539 AGGGAGGGGAGGAAGGAGGAGGG - Intergenic
1134855178 16:17512597-17512619 ATTGAGAAGATAAATGGGGAGGG + Intergenic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1135641701 16:24125339-24125361 ATGGGGAGGAGAAAGAAGAAAGG - Intronic
1135748301 16:25036291-25036313 AAGGAGAGGAGAGGAGAGGAGGG - Intergenic
1136666173 16:31815067-31815089 AGGTAGAGGAGAAAAAAGGAAGG + Intergenic
1137289962 16:47045740-47045762 AAGGAGAGGAGAGGAGAGGAGGG - Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137575116 16:49594284-49594306 AAGGAGAGGAGAGAGGAGGCAGG - Intronic
1137768070 16:50993018-50993040 AGGGAGAGGAGAAAGGAGAAGGG + Intergenic
1137928422 16:52563761-52563783 GTGAAGAGGAGAGAGGAGGATGG + Intergenic
1138013312 16:53404852-53404874 ATTAAGAAGAGAAATGAGGCCGG - Intergenic
1138267120 16:55667623-55667645 ATGAAAGGAAGAAATGAGGAAGG + Intronic
1138439960 16:57028262-57028284 ATGGTGGGGAGGAACGAGGAGGG - Intronic
1138487097 16:57352781-57352803 AGGGAGAGGGGTAATGGGGAGGG + Intergenic
1138489615 16:57368821-57368843 AGGGAGAGAAGAAAGGAGGCAGG + Intergenic
1138509003 16:57497194-57497216 TAGGAGAGGTTAAATGAGGATGG + Intergenic
1138543275 16:57701393-57701415 ATGCAAAGGAGAAAAGAGGTGGG - Intronic
1138582830 16:57952795-57952817 ATGGAAAGAGGAAATGAGGCCGG - Intronic
1138765540 16:59598115-59598137 GGGGAGAGGAGAGAAGAGGAGGG - Intergenic
1139637648 16:68267824-68267846 GGGGAGGGGAGAAAGGAGGAGGG + Intronic
1140063744 16:71592543-71592565 ATGGAGAGGAGGGAGGAGAAAGG - Intergenic
1140092981 16:71852422-71852444 ATGGTGAGGAGAGATGGGGAAGG - Exonic
1140200615 16:72891759-72891781 GTGGTGAGGAGAAAAAAGGAAGG - Intronic
1140317248 16:73911021-73911043 GAGGAGAGAAGAAATGAGAATGG + Intergenic
1140657040 16:77151687-77151709 AAGGAGAGGAAAAATGAGAATGG - Intergenic
1140789732 16:78379929-78379951 ATGGAGAGGAGAAAAGAAAACGG + Intronic
1140886354 16:79247306-79247328 ATGGAGAACAGAAATGAATATGG + Intergenic
1140894677 16:79314527-79314549 ATGGAGGGGAGAGCAGAGGAGGG + Intergenic
1141076497 16:81010497-81010519 ATGGGCAGGAGAAGTGAGGGAGG + Intronic
1141346021 16:83246831-83246853 AGGGAAAGGAGAACTGAAGAAGG - Intronic
1141529736 16:84637889-84637911 GAGGAGAGGAGAAGAGAGGAGGG - Intergenic
1141535384 16:84676248-84676270 CTGGAGAAGAGACATGTGGATGG + Intergenic
1141648363 16:85379313-85379335 ATGGAGAGGAGCAAAACGGATGG - Intergenic
1141729910 16:85815188-85815210 CTGGGGAGGGGAAATGGGGAGGG - Intergenic
1141782075 16:86169234-86169256 AAGGGGATGAGAAGTGAGGAGGG + Intergenic
1142520894 17:503846-503868 AAGGAGAGGAGAGCTGGGGAAGG + Intergenic
1142576600 17:912946-912968 AAGGAAAGGAGAAAAGAGAAAGG + Intronic
1142614716 17:1127587-1127609 CTGGAGAGGAGGAGGGAGGAGGG - Intronic
1143548305 17:7613501-7613523 AGGGGGAGGTGAAATAAGGAAGG + Intronic
1143627780 17:8121171-8121193 ATGGAGAGCAGGACTGAGGGTGG + Exonic
1144083573 17:11786406-11786428 ATGGAAAGGAGAGATGAGGTTGG + Intronic
1144093637 17:11880645-11880667 GTGGAGAGGAAAAGAGAGGAAGG + Intronic
1144221630 17:13105101-13105123 ATGGAGAGAAGACAAGAGGGAGG - Intergenic
1144445730 17:15326356-15326378 ATGAAGCTGAGAAATGAGGAGGG + Intronic
1144674479 17:17153123-17153145 ATGGATATGAGAACTGATGAAGG + Intronic
1144878044 17:18412491-18412513 ACGGTGAGGAGAAAGGAGGGTGG + Intergenic
1145030047 17:19497920-19497942 TTTGAGAGGAGAAATGAGAAAGG + Intronic
1145107026 17:20126264-20126286 AGGGAGAGAAGAAGAGAGGAAGG - Intronic
1145154186 17:20531934-20531956 ACGGTGAGGAGAAAGGAGGGTGG - Intergenic
1145780749 17:27561336-27561358 AAGGAAAGAAGAAATGAGGGGGG - Intronic
1146320895 17:31845525-31845547 ATGGAGAGGAGAATGAAGGAGGG + Intergenic
1146472702 17:33137443-33137465 AAGGAGTGCAGAAATGAGGTGGG + Intronic
1146484474 17:33231853-33231875 ATTGAGATGAGCAATGGGGAGGG + Intronic
1146505215 17:33399091-33399113 ATAGAGATGAGCAAAGAGGAAGG + Intronic
1146526324 17:33570004-33570026 GTGGAGAGGAGTGATGGGGAGGG - Intronic
1146555949 17:33824110-33824132 AGGGAGAGGAGCAATGGGGATGG + Intronic
1146666755 17:34710254-34710276 ATTGAGAGGAGCATAGAGGAGGG + Intergenic
1147232055 17:39026933-39026955 TTGGAGAGCAGAACTGAGGACGG + Intergenic
1148073975 17:44925049-44925071 CAGTAGAGGAGGAATGAGGATGG - Intronic
1148153422 17:45409794-45409816 ATGAACAGGAGCAAGGAGGAGGG - Intronic
1148324997 17:46778165-46778187 AAGGATGGGAGAAATGAGGTTGG - Intronic
1148348702 17:46923008-46923030 AGGGGAAGGAGAAATGAGGCCGG - Intergenic
1148462197 17:47845285-47845307 GTGGAGAGGGGGAAAGAGGAAGG - Exonic
1149628008 17:58093680-58093702 GTAGAGAGGAGTAAGGAGGAGGG - Exonic
1149785795 17:59433889-59433911 GAGGAGAGGGGAAAGGAGGAGGG - Intergenic
1150118560 17:62578232-62578254 ATGGAGAGGAGGGAGGAGGAGGG + Intronic
1150365414 17:64578295-64578317 AGGGAGGGGAGAACTGAGGTGGG + Intronic
1150462350 17:65363174-65363196 AGGGAGAGGAGAGGTGAGCAAGG - Intergenic
1150484410 17:65533752-65533774 GGGGAGAGAAGAAATGAGAAGGG + Intronic
1150510949 17:65752539-65752561 CTGGAGAGGTGGAATGAGAAAGG - Intronic
1150695046 17:67397513-67397535 ATGCAGTGGAGAAATGACGTCGG + Intronic
1150828324 17:68496032-68496054 AAGGAGAGGAGAGGAGAGGAGGG - Intergenic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1151026821 17:70686645-70686667 CTGGAGAGGGGAAAAGAGGTGGG + Intergenic
1151353697 17:73546165-73546187 AGGGAGGGGAGAAAGGCGGAGGG - Intronic
1151724787 17:75877681-75877703 ATGGAGATGGGAAGGGAGGAAGG - Intronic
1151834360 17:76573376-76573398 ATGGGGAGCAGCCATGAGGAGGG + Intronic
1152009385 17:77701838-77701860 ATGAAAGGGAGGAATGAGGATGG - Intergenic
1152099457 17:78292520-78292542 ATGGAGAGGGCAGATGAGGAGGG - Intergenic
1152378394 17:79930054-79930076 GAGGAGAGGAGAAGAGAGGAGGG - Intergenic
1152652974 17:81504579-81504601 GAGGAGAGGAGAAAAGAGGGAGG + Intergenic
1152747220 17:82046667-82046689 ATGGGGAGGATAAATGAGACAGG + Intergenic
1152948201 17:83209923-83209945 GGGGAGAGGAGAGATAAGGAGGG + Intergenic
1152948461 17:83211611-83211633 ATGGAGAGGAGAAAGGAGAGGGG + Intergenic
1152948475 17:83211660-83211682 ATAGAGAGGAGAAAGGAGAGGGG + Intergenic
1152948495 17:83211732-83211754 ATGGAGAGGAGAAAGGAGACGGG + Intergenic
1153069756 18:1091731-1091753 ATGGAGGGAAGAAATGGGGAAGG - Intergenic
1153330417 18:3867666-3867688 GTTGGGAGGAGAAATGGGGATGG + Intronic
1153585047 18:6612349-6612371 TTGGAGAGAAGCAAAGAGGACGG - Intergenic
1153658128 18:7303492-7303514 CTGGGGAGGAGAAGAGAGGATGG - Intergenic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1154084575 18:11290519-11290541 AGGGAGAGAAGAAATGCTGAAGG - Intergenic
1154201113 18:12301587-12301609 AGGGACAGGAGAGCTGAGGATGG - Intergenic
1154341954 18:13510858-13510880 ATGGAGAGGATTAATGTGGCTGG + Intronic
1154348272 18:13562365-13562387 AGGGAGTGGAGAAACGAGGCAGG - Intronic
1155742957 18:29313176-29313198 TTGGAGAGTAGAAATGAGGCAGG + Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1155927910 18:31677750-31677772 GGGGAAAGGAGAAAAGAGGAAGG + Intronic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156477770 18:37417000-37417022 AAGGAAAGGAGAAAGCAGGAAGG + Intronic
1157220406 18:45825253-45825275 AGGGAGAGGAGAAGGGAGGATGG + Intergenic
1157282899 18:46357883-46357905 GAAGAGAGGAGAGATGAGGAAGG - Intronic
1157316396 18:46593557-46593579 ATGGGAGGGAGAAAGGAGGAAGG - Intronic
1157405492 18:47419270-47419292 ATGAAGAGGAGATAGGGGGAAGG + Intergenic
1157470802 18:47986612-47986634 AAGGAAAGGAGTGATGAGGAAGG + Intergenic
1157612719 18:48968449-48968471 AGGGAGGGAGGAAATGAGGAAGG + Intergenic
1157615490 18:48985005-48985027 ATGGAGAGGAGAAATAGGAGAGG + Intergenic
1157627236 18:49060863-49060885 ATGGAGAGGAGAGAAGTGTAAGG + Intronic
1157719814 18:49915015-49915037 TTGCAAAGGAGCAATGAGGAGGG - Intronic
1157992433 18:52512947-52512969 GTGGAGAGAAGAAATGAAGATGG + Intronic
1158265764 18:55659331-55659353 AGGGAAAGGGGAAATGAGGGAGG - Intronic
1158490768 18:57907491-57907513 ATGGAGAAAAGAAATTAGGATGG + Intergenic
1159238073 18:65703426-65703448 AGGGAGAAGAGAAACAAGGAGGG + Intergenic
1159293012 18:66446284-66446306 AAGGAGAGGAGAGGAGAGGAGGG - Intergenic
1159393524 18:67827029-67827051 AAGGAAAGGAGAAAAAAGGAGGG - Intergenic
1159471515 18:68862920-68862942 ATGTAGGGTAGACATGAGGATGG - Intronic
1159785206 18:72705311-72705333 ATGGAGAGAAGAAAGAAGGCAGG + Intergenic
1160067181 18:75586574-75586596 ATGGAGAGGAGAGAGGAGGGAGG - Intergenic
1160090150 18:75819205-75819227 ATGGAGAGGAAGAATGAACATGG + Intergenic
1160102410 18:75935350-75935372 ATGGAGAAGTGAGATCAGGAGGG + Intergenic
1160203011 18:76810612-76810634 ATGGAGAGAAGAAAAAAAGAGGG - Intronic
1160244333 18:77145072-77145094 ATGCAGAGAAGAAATGGGTATGG - Intergenic
1160313245 18:77817442-77817464 ATGGAAAGTAGCAATTAGGATGG - Intergenic
1160356183 18:78229797-78229819 ATGAAGAAGAGAAAGGAGGGAGG - Intergenic
1161403762 19:4080846-4080868 ATGGGGAGGGGAAAGGAGGGAGG + Intergenic
1161659284 19:5536222-5536244 ATGAAGAGGAGAAAGTAGCATGG + Intergenic
1161754166 19:6119429-6119451 ATGGAGAGGAGAGGAGAGGGAGG - Intronic
1161890543 19:7032933-7032955 ATTCAGAGTAGGAATGAGGATGG - Exonic
1161890908 19:7037800-7037822 ATTCAGAGTAGGAATGAGGATGG + Exonic
1161892628 19:7051661-7051683 ATTCAGAGTAGGAATGAGGATGG - Exonic
1161892991 19:7056261-7056283 ATTCAGAGTAGGAATGAGGATGG + Exonic
1162155920 19:8677891-8677913 ATGGAAAGGAGGAAGGAAGAGGG - Intergenic
1162226309 19:9225512-9225534 AAGGAGAGGGGAATTGAGGATGG + Intergenic
1162389377 19:10380226-10380248 GTGGGGACGAGAAAGGAGGAAGG - Intronic
1162835455 19:13314188-13314210 ATAGAAAGGAGAGATGAGGAGGG + Intronic
1163061267 19:14763904-14763926 AGGAAGAGGAGGAAAGAGGATGG - Intronic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1163646783 19:18494060-18494082 GTGGAGAGGAGGAGTGAGGTTGG - Intronic
1163927273 19:20357676-20357698 ACGCAGAGGAGAACAGAGGAAGG + Intergenic
1164163636 19:22648768-22648790 ATGGAAAGCAGAAATAAGCAGGG - Intronic
1164590413 19:29503868-29503890 CTGGAGAGGAGTCATGGGGACGG - Intergenic
1164592624 19:29514554-29514576 AAGGAGAGGGAAGATGAGGAAGG + Intergenic
1164667376 19:30050506-30050528 AAGGAAAGAAGAAAGGAGGAAGG - Intergenic
1164763183 19:30743568-30743590 AAGGAGAGGAGGAAGAAGGAAGG - Intergenic
1164800681 19:31073687-31073709 ACGGAGTGGAGAAAGGAGGGAGG - Intergenic
1165614056 19:37183063-37183085 ATGCTGAGGAAAAATGAGCAGGG + Exonic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165725082 19:38107080-38107102 GTGGAGGTGAGAAATGGGGAAGG - Intronic
1165911342 19:39230105-39230127 AAGGAGAGGAGAGGAGAGGAGGG + Intergenic
1165940058 19:39410419-39410441 TGGGAGAGGAGTAATGAGGGAGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166168472 19:41009443-41009465 ATGGAGAGGTGAGAAGAGGGAGG + Intronic
1166174875 19:41060540-41060562 ATGAAGATGAGAAATAAGGTTGG + Intergenic
1166561793 19:43737551-43737573 GTGGGGAGGAGGAATGAGGCAGG - Intronic
1166939333 19:46353360-46353382 AGGGGGAGGAGAGATGAGGCAGG - Intronic
1167079768 19:47271027-47271049 GTGGAGAGTAGACAGGAGGAAGG - Intronic
1167210822 19:48133156-48133178 ATGGAGAGGAGAACTGCTAATGG + Intronic
1167444837 19:49531472-49531494 ATTGAGAGTAGAACTGAGGGAGG + Intronic
1167631291 19:50627805-50627827 ATGGAGAGAGAAAATGAGAAGGG + Intronic
1167651141 19:50729671-50729693 AGGGAGGGGAGAAAAGGGGAGGG + Intergenic
1168382533 19:55936198-55936220 CTGAAAAGGAGGAATGAGGAGGG + Intergenic
1168416747 19:56174238-56174260 CTGGGAAGGAGAAAGGAGGAGGG - Intergenic
925149870 2:1607560-1607582 AAGGACAGGAAAGATGAGGATGG + Intergenic
925212741 2:2064103-2064125 ATTGACAGCAGAACTGAGGAGGG + Intronic
925264606 2:2558191-2558213 ATGGAGAGAGGAAATGTGGCTGG + Intergenic
925372940 2:3360932-3360954 AAGGGGAGGAGAAGGGAGGAGGG + Intronic
925402563 2:3586022-3586044 GAGGAGAGGAAAAAGGAGGAGGG + Intergenic
925441034 2:3885466-3885488 ATGAAGAAGTGAAAGGAGGAAGG - Intergenic
925476435 2:4221916-4221938 CTGGAGAAGAGAGATGGGGAAGG + Intergenic
925485738 2:4328335-4328357 AGAGAGAGGAGAAATGAGCCAGG + Intergenic
926069787 2:9877832-9877854 AGAGAGAGGAGAAAAGAGGGAGG - Intronic
926366075 2:12134042-12134064 ATGGAGAGAGGGAAGGAGGATGG - Intergenic
926494721 2:13571921-13571943 ATTCAGATGAGAAATGATGATGG - Intergenic
926714438 2:15913000-15913022 ATGGAGAGAAGAAAGGAAAAAGG - Intergenic
927197153 2:20555879-20555901 ATGCAGAGGTGAAGTGGGGAAGG - Intergenic
927446349 2:23165452-23165474 ATGCAGGGGAGAAATGAGGTCGG + Intergenic
927855824 2:26527471-26527493 CTGGAGAGGCGAAAGGTGGAGGG - Intronic
928076440 2:28269274-28269296 ATGGAGAGGAGAAGGGGGAAGGG - Intronic
928360278 2:30657030-30657052 AGGAAGAGGAGAAGGGAGGAAGG - Intergenic
928667444 2:33564088-33564110 ATGGAGAAAAGAAAGGAGAAAGG - Exonic
929085620 2:38164724-38164746 CTGGAGAGGAGAGATGAAGAGGG - Intergenic
929838193 2:45427444-45427466 ATGGAAAGGAAAAATAAGCAGGG + Intronic
929906221 2:46048852-46048874 CTGGGAAGGAGAAAGGAGGAGGG - Intronic
930110941 2:47678008-47678030 ATGGTGTGGAGAAATGGGGATGG - Intergenic
930350064 2:50240382-50240404 ATGTAGAAGAGAGCTGAGGAAGG - Intronic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930778322 2:55197120-55197142 AAGGAGAGGAAAAAATAGGAAGG + Intronic
931119081 2:59196505-59196527 AAGGAGAGGTGACATGAGCAGGG + Intergenic
931123398 2:59246088-59246110 GGGGAGAGGATAAAAGAGGATGG - Intergenic
932074714 2:68651989-68652011 ATGGAGAGGAAAGAGGAGAAGGG + Intronic
932153100 2:69390863-69390885 TTGGAGAGGAGTATTGGGGAGGG - Intergenic
932178674 2:69625855-69625877 GTGGAGAGAAGAAATGACAAAGG - Intronic
932543381 2:72680817-72680839 ATGGTGTGGTGAAATGGGGATGG - Intronic
932727228 2:74189799-74189821 AAGGAGAGGGGAAAGGAGAAGGG + Intergenic
933242655 2:79940475-79940497 AGGGATAGAAGAAGTGAGGATGG - Intronic
933335377 2:80951226-80951248 ATGGAGATGAAAAATGAAGCTGG - Intergenic
933639652 2:84745874-84745896 ATGGAGAGGAGACATTTGAAGGG + Intronic
934622275 2:95820709-95820731 ATGGAAAGCAGAAATAAGCAGGG - Intergenic
934873072 2:97885873-97885895 AAGGAGAAGAGAAAGGAGAAAGG - Intronic
934901784 2:98165581-98165603 AGTTAGAGGAGAAATGGGGATGG + Intronic
934923388 2:98364437-98364459 ATGGAAAGGAGAAAAAAGCAGGG - Intronic
935147837 2:100408321-100408343 ATGGAGTGGCGGAAGGAGGAGGG - Intronic
935195509 2:100812638-100812660 ACGGGGAGAAGAATTGAGGAAGG + Intergenic
935580302 2:104750497-104750519 AGGGAGAGGAGAAAGGGAGACGG - Intergenic
935867522 2:107406638-107406660 ATGCAGAGTAGAAATGAGGCTGG - Intergenic
936249124 2:110853846-110853868 AAGGAGAGGAGAGAGGAAGATGG - Intronic
936445786 2:112594098-112594120 AAGAAGAGTAGAAATGTGGAGGG - Intergenic
936448880 2:112618529-112618551 AGGGAAAGGAGGAATGAAGAAGG + Intergenic
936548565 2:113414292-113414314 ATAGGGAAGAAAAATGAGGAAGG - Intergenic
936820085 2:116510127-116510149 ATGGAAAGGGGGAAAGAGGAAGG - Intergenic
936844624 2:116816036-116816058 ATGGAAGGGAGAAAAGGGGAGGG + Intergenic
937436426 2:121885547-121885569 TTGGAGAGGAGGAAAGAGAAAGG - Intergenic
937642788 2:124232609-124232631 CTCAAAAGGAGAAATGAGGAGGG - Intronic
938189154 2:129258805-129258827 ATGTAGAGGAGGAGTGTGGAGGG + Intergenic
938948016 2:136231535-136231557 ATGGAGAGGAGACGTGACCAGGG + Intergenic
939165750 2:138639630-138639652 ATAGAGATAAGAAATGAGGTAGG + Intergenic
939219408 2:139282059-139282081 ATGGCTAGGAGACATGAAGATGG + Intergenic
939230012 2:139412415-139412437 AGAGAGAGGAGATATGATGATGG + Intergenic
939284602 2:140112709-140112731 AGGGAGAGAAGGAAGGAGGATGG + Intergenic
939340974 2:140895733-140895755 ATGGAGAGCTGAAAAGGGGATGG + Intronic
939360777 2:141169725-141169747 ATGGAGACAAGATATGAGAACGG + Intronic
939390535 2:141563517-141563539 AAGGAGAGGATAAAAGAAGAGGG + Intronic
939396923 2:141642619-141642641 ATAGAAAGGAGAAATCAGGGAGG + Intronic
939409637 2:141807917-141807939 ATGGAGTGGACATAGGAGGATGG + Intronic
939523171 2:143258678-143258700 ATGTTGGGGAGAAATCAGGAAGG + Intronic
939596907 2:144136442-144136464 AAGGAAAGGAGAAAGGAGGAAGG + Intronic
940045033 2:149400945-149400967 ATGGAAAGATGAAATGAGAATGG - Intronic
940094761 2:149962257-149962279 ATGGAAAGGAGAAAAAAGCAAGG - Intergenic
940894240 2:159064911-159064933 GGGGAGGGGAGGAATGAGGACGG - Intronic
941132440 2:161670266-161670288 AGGAAGAGAAGAAAAGAGGAAGG - Intronic
941219655 2:162760596-162760618 ATTTAGAGGAGTAATGAGAAGGG - Intronic
941841277 2:170087347-170087369 AGCCAGAGGAGAGATGAGGATGG + Intergenic
941880578 2:170476487-170476509 ATGGAGAGCTGGAATGGGGATGG + Intronic
941880675 2:170477108-170477130 ATGGTGGGGAAAAATGAGAATGG - Intronic
942593663 2:177571861-177571883 ATGGAGAGGTAAACTGAGGTTGG + Intergenic
943332260 2:186573523-186573545 ATTAAGAGGAAAAATGAGGAAGG + Intergenic
943990601 2:194686169-194686191 ATGCAAAGAAGCAATGAGGAGGG - Intergenic
944368511 2:198953859-198953881 ATGGAGAGGGTAAAGGAAGATGG - Intergenic
944472535 2:200069833-200069855 ATGTTGAAGAGAAATGAGAATGG - Intergenic
944958717 2:204843382-204843404 GAGGAGAGGAGAGAAGAGGAAGG - Intronic
945201369 2:207285088-207285110 ATGGAGATGAGAGATAAGGCTGG + Intergenic
945335657 2:208589826-208589848 TTGGATAAGAGAAAAGAGGACGG + Intronic
945454650 2:210036105-210036127 AGGGAGATGAGAAATGGGCAAGG - Intronic
945544040 2:211126773-211126795 AGAGAGAGGAGAAAGGAGGAAGG - Intergenic
945723977 2:213452377-213452399 ATGTAGAGGAGCAACAAGGATGG - Intronic
945766054 2:213978999-213979021 AAAGAGAGGAGAAATAAGGACGG + Intronic
946121360 2:217517919-217517941 CTGCTGAGAAGAAATGAGGATGG + Intronic
946531230 2:220572464-220572486 ATGTTGATGAGAAATGAGGCTGG + Intergenic
946658579 2:221975666-221975688 TTGGAGAGGAAAATTGAGAATGG - Intergenic
946759886 2:222982998-222983020 ATGGAGACGGGAAGTGGGGAAGG - Intergenic
946873141 2:224102802-224102824 ATGGAAAGGAAATAAGAGGAAGG - Intergenic
946895458 2:224319274-224319296 ATGGAAAGGAGAGGAGAGGAGGG + Intergenic
947046429 2:225992025-225992047 AAGGAGGGGAGAAAAGAGCAGGG - Intergenic
947960281 2:234230466-234230488 AGGGAGAAGAGAAATGAGCTTGG + Intergenic
947983963 2:234433485-234433507 AAGGAAAGCTGAAATGAGGACGG + Intergenic
948081738 2:235212120-235212142 AAGGAAAGGAGAAAGGGGGAGGG - Intergenic
948215904 2:236231071-236231093 AAGGAGAGGAGAGAAGAGCATGG - Intronic
948329077 2:237150927-237150949 GTGGAATGGAGAAATGAGAATGG - Intergenic
948381193 2:237551041-237551063 ATGGCGGGGAGAAATGTGAAGGG - Intronic
948565515 2:238883945-238883967 ATGCAGAGGAGAAGGAAGGACGG - Intronic
948748259 2:240111013-240111035 ATGGCGTGTAGAAATGAGGAAGG + Intergenic
948766252 2:240222522-240222544 AAGGAAAGGAGAAAGGAGAAAGG - Intergenic
948974715 2:241457257-241457279 ACGGGAGGGAGAAATGAGGAAGG - Intronic
1168854905 20:1001803-1001825 ATGGTCAGCAGAAAGGAGGATGG - Intronic
1168950450 20:1796552-1796574 ATGGTGAAGAGAAATGATGTGGG - Intergenic
1169004039 20:2192216-2192238 GTGGAGAGGAGGAAGGATGACGG - Intergenic
1169038088 20:2470199-2470221 ATGGAGAGGAGGGCGGAGGAGGG - Intronic
1169118830 20:3083539-3083561 AGGGCGAGGAGGAAGGAGGAAGG - Intronic
1169226138 20:3858185-3858207 TGGGGGAGAAGAAATGAGGAAGG - Intronic
1169235385 20:3926051-3926073 ATGGAGAGGGGAGAAGTGGATGG + Intronic
1169250071 20:4053544-4053566 AAGGAGCGGAGAAGGGAGGATGG + Intergenic
1169266549 20:4170726-4170748 ATGGAGAGAGGAAAAGAGGGAGG - Intronic
1169727900 20:8755815-8755837 TTGTAAAGGATAAATGAGGAGGG + Intronic
1169824933 20:9757111-9757133 TAGGAGAGGAGAAATGAGACAGG - Intronic
1169894789 20:10491414-10491436 ATGGAGAAGACAAAGGAGCAAGG - Intronic
1170180586 20:13525445-13525467 TGGGTGAGGAGAAATGAGTAAGG - Intronic
1170371800 20:15657032-15657054 AAGGAAAGGAGAAAGAAGGAAGG + Intronic
1170459617 20:16564962-16564984 ATGGAGAGAGGAAGGGAGGAAGG - Intronic
1170503240 20:16996554-16996576 ATGGAGGGAAGGAAAGAGGATGG - Intergenic
1170797156 20:19558059-19558081 ATGGGGGAGGGAAATGAGGATGG + Intronic
1170876366 20:20253977-20253999 ATGGAGAGGAGAGGAGGGGAGGG - Intronic
1171001672 20:21421966-21421988 AGGGAGAGGAGAAGAGCGGAAGG - Intergenic
1171322382 20:24257921-24257943 CTACAGAGGAGAAATGTGGATGG + Intergenic
1171757090 20:29120480-29120502 AGGGACATGAGAAATTAGGAAGG - Intergenic
1172324900 20:34026735-34026757 AGGGAGCAGAGAAAAGAGGATGG - Intronic
1172602381 20:36192797-36192819 ATGTAGAGTAGCCATGAGGAGGG + Intronic
1172677863 20:36687341-36687363 AAGGAGAGAAAATATGAGGATGG + Intronic
1172891398 20:38268475-38268497 AAGGAGAGGGGGAATGAAGAAGG - Intronic
1172898328 20:38316220-38316242 ATGGAGGGAAGAAAAGGGGAAGG - Intronic
1173161188 20:40653627-40653649 AGGGAAATGAGAAATGAGGCAGG + Intergenic
1173225697 20:41161365-41161387 ATGGAGGGGAGCAAAGAAGAGGG + Intronic
1173284718 20:41659814-41659836 ATGGAGGTGAGAGATGAGGATGG - Intergenic
1173513686 20:43650000-43650022 AGGGAGAGGAGAGGAGAGGAGGG + Intergenic
1173619541 20:44426234-44426256 AAGGAGAGGTGAAGAGAGGAGGG + Intronic
1173669493 20:44788475-44788497 ATGAAGAGGAGACAGGAGGTGGG + Intronic
1173755412 20:45511487-45511509 ATGGAGGGCAGAATTGAAGAGGG - Intergenic
1173916391 20:46711320-46711342 ATGGAGAGGAGAAGCTGGGAAGG + Intronic
1174158680 20:48534790-48534812 AAGAAGTGGAGAAATGAGGGGGG + Intergenic
1174163122 20:48565606-48565628 TTGGAGGGACGAAATGAGGAAGG - Intergenic
1174664560 20:52245844-52245866 CTGGGTAGGAAAAATGAGGATGG + Intergenic
1174796391 20:53526070-53526092 AAGGAAAGAAGGAATGAGGATGG - Intergenic
1175062786 20:56258927-56258949 GTGGAGAGAAGAAATGAGGAGGG + Intergenic
1175093685 20:56524788-56524810 ATGGTGAGCAGAGATGGGGAAGG - Exonic
1175094875 20:56533321-56533343 ATGGTGAGCAGAGATGGGGAAGG - Exonic
1175287694 20:57848717-57848739 AGGGAGAAAGGAAATGAGGAAGG - Intergenic
1175461719 20:59156659-59156681 TAGGGGAGGAGAAATGGGGAAGG - Intergenic
1175657774 20:60786927-60786949 AAGGGGAGGAGGAAGGAGGAGGG - Intergenic
1175848784 20:62075426-62075448 GAGGAGAGAAGAAATGAGGCAGG + Intergenic
1176529004 21:7943684-7943706 ATGGAGAGGAATAAAGTGGAAGG - Intergenic
1176648985 21:9528874-9528896 ATGGAGGGGAAAAAAGAGGGTGG - Intergenic
1176757768 21:10738416-10738438 GTGGAGAGGAGAGGTGTGGAGGG - Intergenic
1177047073 21:16183881-16183903 AGGAAAAGGAGAAAAGAGGAAGG - Intergenic
1177115126 21:17075821-17075843 TTGGAGAAGGGAAATGAGCATGG + Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178399781 21:32275615-32275637 AGGGTGAAGAGAAATGAAGAAGG + Intronic
1178746424 21:35255108-35255130 AAACAGAGGAGAGATGAGGAAGG + Intronic
1179016309 21:37596810-37596832 AGGCAGAGGAGAACAGAGGAAGG - Intergenic
1179084814 21:38207421-38207443 AGGGAGAGGAGAAGGGAGAAGGG - Intronic
1179084849 21:38207579-38207601 GAGGAGAGGAGAAAAGAGGAGGG - Intronic
1179352826 21:40629490-40629512 AACAAGAGGAGAAGTGAGGAAGG + Intronic
1179403771 21:41108705-41108727 AGGGAGAGGAGAGAGGTGGAGGG + Intergenic
1179572548 21:42286536-42286558 ATGGAGAGGAGACAGGGCGAGGG + Intronic
1180021568 21:45131696-45131718 ACTGAAAGGAGAAGTGAGGAGGG + Intronic
1180709128 22:17827798-17827820 AAGGGGTGGAGAAATGAGGTGGG + Intronic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1180923182 22:19533088-19533110 AAGGAGAGGAGAAAGGGGGTGGG + Intergenic
1180936611 22:19629641-19629663 CTGGAGAGGAGAATGGAGGCTGG + Intergenic
1181762459 22:25067636-25067658 ATGGAGAGAGGAAGAGAGGATGG - Intronic
1181885311 22:26017379-26017401 AGGGAGAGGAGGAAGGAGGAGGG - Intronic
1181912862 22:26254342-26254364 AGGAAGAGGAGAAGTGAGGAAGG + Intronic
1181924746 22:26348961-26348983 AGGGAGAGGAGAGGAGAGGAAGG + Intronic
1181992420 22:26847489-26847511 ATGCAGAGAAGGAATGAGCAAGG - Intergenic
1182320513 22:29475925-29475947 AGGGAGAGGAGAAAAAAGGAGGG + Intergenic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182458215 22:30466085-30466107 ATGGACAGGAGAAATAAGGGAGG + Intronic
1182760514 22:32718879-32718901 ATGTAGAGGAGAAATGGGACAGG - Intronic
1182779167 22:32853707-32853729 AAGGAGAGGAGGAATGAGTTTGG - Intronic
1182931386 22:34177480-34177502 AGGGAGAGGTGGAAGGAGGAGGG - Intergenic
1183021713 22:35032804-35032826 ATGAAGAGGACAGAGGAGGAGGG + Intergenic
1183137407 22:35902331-35902353 ATGGAGAGGACAAATGATTGAGG - Intronic
1183159925 22:36106049-36106071 AAGGAGAGGAGAAAAGTGGCAGG - Intergenic
1183596951 22:38818603-38818625 AGGGAGAGGAGAAAGGGGCAAGG + Exonic
1183613058 22:38923701-38923723 AGGGAGGGAAGAAAGGAGGAGGG - Intergenic
1183613073 22:38923750-38923772 AGGGAGGGAAGAAAGGAGGAGGG - Intergenic
1183613087 22:38923799-38923821 AGGGAGGGAAGAAAGGAGGAGGG - Intergenic
1183616770 22:38950498-38950520 AAGGAAAGGAGAAGAGAGGAGGG + Intergenic
1183732760 22:39627881-39627903 ATGGGGAGATGAAATGAGGGGGG + Intronic
1184078883 22:42203761-42203783 AGGGAGAGGAGAATGGAGAAAGG + Intronic
1185021842 22:48381089-48381111 ATGGACAGGTGAAATGCAGATGG + Intergenic
1185161691 22:49233823-49233845 AGGGTGATGAGAAATGAGCAAGG + Intergenic
949155931 3:827267-827289 ATGGAGAGGAAAAAGTGGGAAGG + Intergenic
949167263 3:957816-957838 AAGGAGAGTAGACATGAAGAGGG + Intergenic
949914177 3:8944594-8944616 AGGGGAAGGAGAAAGGAGGAGGG + Intronic
950755880 3:15172050-15172072 ATATATAGGAGAAAGGAGGAGGG - Intergenic
951075642 3:18388364-18388386 GTGGAGAGGAGTAAAGAGCAAGG - Intronic
951269225 3:20604290-20604312 AGGGAGACTAGAAATGAAGAAGG + Intergenic
951853698 3:27170921-27170943 ATGGAGAGGAGAAATGAGAGAGG - Intronic
951914908 3:27790347-27790369 ATAGGGAGGGGTAATGAGGAGGG + Intergenic
952519264 3:34139083-34139105 GTGGAGAGGAGAAAGGCAGAAGG - Intergenic
952786191 3:37157553-37157575 AGAGAGAGGGGAAAAGAGGAAGG + Intronic
952871604 3:37905914-37905936 ATGAAGAGGAGAGAAGAGTATGG + Intronic
953205274 3:40822288-40822310 TTGGAGAGGAGATAAGAGGGTGG + Intergenic
953225302 3:41013498-41013520 ATAGAGTGGGGAAATGAGGCAGG + Intergenic
953273869 3:41475886-41475908 AAGGAGGGAAGAAAAGAGGAAGG + Intronic
953382157 3:42480154-42480176 ATGGAGTGGGCAGATGAGGAGGG + Intergenic
953483755 3:43275099-43275121 ATAGAAAGGAGAAAAGAGGAGGG - Intergenic
954508842 3:51104053-51104075 TTTGATAGGATAAATGAGGAGGG + Intronic
954652162 3:52171849-52171871 ATGGACAGGAGAGAAGAGAAAGG + Intergenic
954745781 3:52786878-52786900 ATGGATAGGTGAAAGGATGAGGG + Intronic
954793860 3:53151575-53151597 ATAGAGAGTAGACAAGAGGAGGG - Intergenic
955159190 3:56447431-56447453 AGGGAGACGAGAAGTGGGGAAGG + Intronic
955949631 3:64229381-64229403 ATGAAGAGCTGTAATGAGGAAGG + Intronic
956106293 3:65822181-65822203 AAGGAGGGGAGAAATGAAAAAGG + Intronic
956217326 3:66861889-66861911 GAGGAGAGGAGAAAAGATGAAGG + Intergenic
956310584 3:67874862-67874884 ATGGATAGGAGAGGTTAGGATGG - Intergenic
956340760 3:68221286-68221308 ATGGGAAGGAGAAAAGAGAAGGG - Intronic
956403414 3:68903901-68903923 ATGGAAAGGAGGAAAGAGGGAGG - Intronic
956624106 3:71249758-71249780 AGGGAGAGGGAAAGTGAGGAGGG + Intronic
956695087 3:71911902-71911924 ATGGTGAAAAGAAATAAGGATGG + Intergenic
956761967 3:72451642-72451664 CCAGAGAGGAGAAATGAGGCTGG + Intergenic
956995463 3:74822453-74822475 ATGGAGACCAAAAATGAGAAGGG - Intergenic
956997014 3:74838151-74838173 ATGAAAAGGAGAAATGTGGTGGG + Intergenic
957192623 3:77029351-77029373 ATGTAGAAGAAAAATGATGAGGG + Intronic
957542891 3:81598371-81598393 ATTGTGAGGAAAAATGAGAAAGG + Intronic
957683413 3:83469638-83469660 AAGGAGAGGAGAGAAGAGGAGGG + Intergenic
957847121 3:85752423-85752445 AGGGAGAGAAGAAAAGAGAAGGG - Intronic
958536825 3:95414758-95414780 AGAGAAAGAAGAAATGAGGAAGG + Intergenic
958877735 3:99635039-99635061 ATGGAGAGGAGGGATGAGGAGGG - Intergenic
959343447 3:105161147-105161169 GTGGAGAGAAGACAAGAGGAGGG - Intergenic
959369061 3:105500275-105500297 AAGGAGATGAGAAAAGAGGAAGG - Intronic
959651718 3:108757001-108757023 AAGAACAGGAGAAATGAGCAAGG + Intronic
959653705 3:108777306-108777328 ATGGAAGGGAGAATGGAGGATGG - Intergenic
960203824 3:114870874-114870896 AGAGACAGGAAAAATGAGGAGGG - Intronic
960358178 3:116678771-116678793 ATGGAGAGCTGGAATGGGGATGG - Intronic
960553269 3:119000644-119000666 ATTCAGATGAGAAATGATGATGG - Intronic
960707986 3:120499739-120499761 AAGGAGAGTAGATATGAAGAGGG + Intergenic
960912586 3:122664178-122664200 AGGGAGAGTAGACATGAAGAGGG - Intergenic
961011166 3:123437063-123437085 GGGGAGTGGAGAAATGAGAAAGG + Intronic
961115353 3:124324359-124324381 ATAGAGAGGAAGAATGGGGAGGG - Intronic
961187374 3:124927477-124927499 ATGGAGAGTACAATTGTGGAGGG - Intronic
961282511 3:125775020-125775042 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
961485757 3:127214680-127214702 AAGGAGAGGAGAAAGGTGGGGGG + Intergenic
961695024 3:128698500-128698522 TTGGCGGGGAGAAATGCGGAGGG + Intergenic
962221608 3:133569062-133569084 CTGGAGAGTAGAAAAGAGGAAGG - Intergenic
962385986 3:134933173-134933195 AGAGAGAGGAGAAAAAAGGATGG - Intronic
962457423 3:135577504-135577526 ATGAAATGGAGAAATTAGGATGG - Intergenic
962803443 3:138909826-138909848 ATGGAGAAGAGAGGGGAGGAAGG + Intergenic
962865938 3:139448083-139448105 AGGAAGAAGAGAAAGGAGGAAGG - Intergenic
963002541 3:140695690-140695712 AGGAAGAGGAAAAATCAGGAAGG - Intronic
963296006 3:143547536-143547558 ATGGAGAGCCCAAATGAGGTGGG - Intronic
963465682 3:145678532-145678554 ATGGACAGGAGATCAGAGGACGG - Intergenic
963762145 3:149294932-149294954 ATGGACAGGAGACAGGAAGAGGG + Intergenic
963764132 3:149316116-149316138 ATGGAGAGGAGAAAAGATGCAGG + Intergenic
964041466 3:152267216-152267238 GTGGAGAAGAGAAAAGAGCAGGG - Intronic
964187145 3:153959758-153959780 ATTTAGAGGAGAAAAGAAGATGG + Intergenic
964195026 3:154053793-154053815 GTGGAGAGGAGAAATAATGTGGG - Intergenic
964233257 3:154495482-154495504 AGGGAGAGGAGAAATGAGAACGG - Intergenic
964731574 3:159872376-159872398 ATGGAAAGGGGCAATTAGGATGG - Intronic
965803548 3:172518513-172518535 ATGGGGAGGAAAAAGGAGAAGGG - Intronic
965949923 3:174296566-174296588 GTGGAGAGCAGAAGTGATGAAGG - Intergenic
966354218 3:179061992-179062014 ATGGAGAGGAAAAAAAAGGTAGG + Intronic
966409116 3:179630605-179630627 GTGCAGAGGAGAAAAGAGGTAGG + Intergenic
966566196 3:181384034-181384056 TTGAAAGGGAGAAATGAGGAGGG + Intergenic
967470245 3:189852604-189852626 ATTCAGACAAGAAATGAGGAAGG - Intronic
967479414 3:189956782-189956804 CTGGATAGCAGCAATGAGGAGGG + Exonic
967664887 3:192159085-192159107 AGGAAGTAGAGAAATGAGGAGGG - Intronic
967953356 3:194857938-194857960 AGGGAGAGAAGAAATGAGGCAGG - Intergenic
968181107 3:196596110-196596132 ATGGAGGGGAGAAGTGTGGGTGG - Intergenic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
969015216 4:4099377-4099399 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
969089832 4:4685422-4685444 AGGGAGAGGGCAAAGGAGGATGG + Intergenic
969738718 4:9008874-9008896 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
969779382 4:9385950-9385972 ATGGAGATGAGATATCAGGCAGG + Intronic
969797922 4:9540519-9540541 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
969940367 4:10725542-10725564 CTGGGGAGGGGAAATGGGGATGG - Intergenic
969979865 4:11143474-11143496 ATGGAGAGAAGCAAGGAGGGAGG - Intergenic
970114380 4:12677310-12677332 ATGTGGTGGATAAATGAGGATGG + Intergenic
970320189 4:14867821-14867843 GGGGAAAGGAGAAATAAGGAGGG + Intergenic
970803944 4:20007728-20007750 AGGGAAAGGAGGAATGAGAAGGG + Intergenic
970899175 4:21138825-21138847 ATGGAAAGGAGTCATGAGGCAGG + Intronic
971127501 4:23770510-23770532 CTGGAGCGGAGACATGTGGATGG - Intronic
971146937 4:23987689-23987711 ATTGAGTGGAGAAATGAGACAGG - Intergenic
971312380 4:25536579-25536601 TGGGAGAGGAGATAAGAGGAGGG - Intergenic
971399322 4:26261429-26261451 AAGTAGAAAAGAAATGAGGAAGG + Intronic
971481300 4:27117241-27117263 ATGGAGAGTATAAGTGAGGTCGG - Intergenic
972129333 4:35810314-35810336 AGGAAGAGGGGAAAGGAGGAGGG + Intergenic
972176960 4:36419923-36419945 GTGGAGAGGGGATGTGAGGATGG - Intergenic
972279076 4:37585508-37585530 GGGGAGAGGAGAAATGTTGAGGG + Intronic
972450844 4:39196819-39196841 TTGGAGCAGACAAATGAGGAGGG - Intronic
972662613 4:41130757-41130779 ATGGGGAGCAGAAGTGGGGAGGG - Intronic
972868112 4:43259506-43259528 AAAGAGGAGAGAAATGAGGATGG - Intergenic
972947524 4:44275141-44275163 ATGGAGTGTAGAAATGAGACAGG + Intronic
973103382 4:46300143-46300165 ATGGAAATAAGAAATGAGAAAGG - Intronic
973184306 4:47306437-47306459 AGGGAGAGGAGAAGGGAGGGAGG + Intronic
973894493 4:55397669-55397691 ATGGAAAGGAAAAAGGAGAAAGG - Intronic
974291364 4:59935729-59935751 AGAGAGAGTAAAAATGAGGATGG + Intergenic
974473896 4:62355191-62355213 AGGGAGAGGAGAGGAGAGGAGGG - Intergenic
974473918 4:62355241-62355263 AAGGAGAGGAGAGGAGAGGAGGG - Intergenic
974600814 4:64076762-64076784 ATGGGGAGGAATAATGTGGATGG + Intergenic
975100673 4:70509397-70509419 AAGGAGAAGAGATCTGAGGAGGG + Intergenic
975411606 4:74058477-74058499 AAGGGGAGGAGAAGTGAGAAGGG - Intergenic
975495405 4:75030852-75030874 AGGGACAGAAAAAATGAGGAAGG - Intronic
975757006 4:77580830-77580852 AGGGAGAGGGGAAAGGAGGAGGG - Intronic
976017020 4:80568692-80568714 ATGGAGAGGAGAAAGAAGAAAGG + Intronic
976090656 4:81453833-81453855 ATAGAGATGAGAAAGGAGCAAGG + Intronic
976115096 4:81717528-81717550 ATGGAAAGTAGAAAAAAGGAGGG + Intronic
976366110 4:84234139-84234161 ATGGAGAATAAAAATGATGAAGG + Intergenic
976615273 4:87069631-87069653 AAGGAGAAGAGAAAAAAGGAAGG - Intronic
977373839 4:96174350-96174372 AGGGAGGAGAAAAATGAGGAGGG - Intergenic
977846588 4:101773969-101773991 ATGGAGAGCAGAGAGGAGCAAGG - Intronic
978278909 4:106985875-106985897 AGGGAGAGAAGAAAGGAGGGAGG + Intronic
978438387 4:108709715-108709737 ATGGAGAGAAGAAAAGAGTGTGG - Intergenic
978769022 4:112434223-112434245 ATTGAGAGAAGAAAAGAGGAAGG - Intronic
978849191 4:113312665-113312687 ATGGTGAGGAAAAGTGGGGAGGG + Intronic
979058511 4:116025297-116025319 CAGGAGAGGAGAAATGAGACAGG - Intergenic
979277590 4:118830927-118830949 ATGGAAAGGAGAAAGCAGGTAGG + Intronic
979348546 4:119619004-119619026 ATTGAAAAGAGAAAAGAGGATGG - Intronic
979522327 4:121682663-121682685 ATGGAGTGGAGAGAGGAGAAGGG - Intronic
979736517 4:124092499-124092521 TTGGAGAGGAGAAATGCAGGAGG + Intergenic
979821612 4:125180483-125180505 AAGGAAAGGAGAAAGGAGAAAGG + Intergenic
979888798 4:126064149-126064171 AGGCAGAGGAGAAAAAAGGAAGG + Intergenic
979960513 4:127015311-127015333 ATTGGGATGAGGAATGAGGAAGG - Intergenic
980556934 4:134419806-134419828 ATGTAGAGTAGATATGAGGGGGG - Intergenic
980592468 4:134908471-134908493 ATGGAGAGGAGAGACGATCAAGG - Intergenic
980657736 4:135811741-135811763 AAGGAGAGGAAAGATTAGGAAGG + Intergenic
980808173 4:137840316-137840338 AGGAAGTGGAGAAATGGGGAGGG + Intergenic
980999420 4:139814283-139814305 TTGGAGAGCAGAAATCAGGATGG + Intronic
981116396 4:140995652-140995674 ATGGAGATGAGATAGGAGGCGGG - Intronic
981308102 4:143267934-143267956 ATGGGGAAGAGAAATGTGGTTGG + Intergenic
981317414 4:143353106-143353128 ATGAAGAGGAGAGATGAAGGAGG + Intronic
982010630 4:151102626-151102648 ATGGAGGGTAGAAAGGAGGAGGG + Intronic
982366286 4:154583021-154583043 AAGGAGAGGAGAAGAGAGGGAGG - Intergenic
982905408 4:161063147-161063169 AAGGAGAGGGTAAAAGAGGAAGG - Intergenic
982924243 4:161316043-161316065 ATGAAGAGGGAAAATTAGGATGG + Intergenic
983335997 4:166393238-166393260 ATGGAGAGGAAAAATGGGGTTGG - Intergenic
983449388 4:167891536-167891558 AAGGAGAGGAAAAAAGAGGTGGG + Intergenic
983484408 4:168317416-168317438 ATGGAAAAGAGAAAAAAGGAGGG + Intronic
983671592 4:170244168-170244190 ATGGAAAGAAGAAATGGGGTGGG - Intergenic
984064679 4:175033303-175033325 GTGGAGAGGGGAAAAGAGGGTGG + Intergenic
984071299 4:175116576-175116598 ATGGATAGGAAAAATTAAGATGG + Intergenic
984262010 4:177453480-177453502 AAGGAGAGGAGAGCAGAGGAAGG - Intergenic
984579031 4:181488387-181488409 ACAGAGATGAGAAATCAGGAGGG - Intergenic
984703717 4:182833812-182833834 GGGGAGAGGAGAAGGGAGGAGGG - Intergenic
984703945 4:182834458-182834480 GGGGAGAGGAGAAGGGAGGAGGG - Intergenic
985179322 4:187239512-187239534 ATGGAGGGAAGAAAGGAGAAAGG - Intergenic
985208642 4:187568425-187568447 ATGGAGGGAGGGAATGAGGAAGG - Intergenic
985331442 4:188841151-188841173 ATGGAAAAGAGAGATGTGGAGGG + Intergenic
985361022 4:189175754-189175776 GTGGAAAGGACACATGAGGAAGG - Intergenic
986212472 5:5687068-5687090 TGGGAGAGGAGAAGTGAGGCTGG - Intergenic
986296691 5:6445175-6445197 ATGGGCTGGAGAACTGAGGAAGG + Intergenic
986362554 5:6994395-6994417 ATGGAGAGTAGAAACAAGAAAGG - Intergenic
986889820 5:12288747-12288769 AGAAAGAGAAGAAATGAGGAAGG - Intergenic
987143098 5:14965356-14965378 AAGGAGAGGAGAAAGAAGGTGGG - Intergenic
987154045 5:15070003-15070025 TTGTAAAGGAAAAATGAGGAGGG + Intergenic
987250983 5:16101127-16101149 ATGGAGAGATGAGATGTGGATGG - Intronic
987306258 5:16640588-16640610 AGGGAGGGGAGGGATGAGGAGGG + Intergenic
987557446 5:19472635-19472657 ATGGAGAAAAGAACTGGGGAGGG + Intergenic
987944892 5:24593424-24593446 CTGGAGAGCAGAAATGTGGCAGG + Exonic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988202591 5:28086586-28086608 AAGAAGAGAAGAACTGAGGAGGG + Intergenic
988346712 5:30046288-30046310 ATGGAGAGGAGAGGGAAGGAAGG + Intergenic
988395201 5:30688287-30688309 AAGGAGAGTAGAAATGTGAAAGG - Intergenic
988457621 5:31400641-31400663 ATGGGGAGCAGGAAGGAGGAGGG - Exonic
988545158 5:32149193-32149215 ATGCAGAGTAGAAATGAGAGAGG + Intronic
988947809 5:36224097-36224119 ATGGGGAAGAGAGATGAGTAGGG + Intronic
988948310 5:36230206-36230228 ATGGGGAGGAAAAATGAGGTAGG - Intronic
989165944 5:38433683-38433705 ATGGAAAGAGGAAAGGAGGAAGG - Intronic
989183870 5:38604271-38604293 GTGGAGAGGAGAAAGGGGCAAGG + Intronic
989185526 5:38621635-38621657 ATGGAGCTGAGATATGAGGAAGG - Intergenic
989238978 5:39181789-39181811 ATGGAGATGAGAAAAGAGGTTGG - Intronic
989287161 5:39715005-39715027 ATGGAGAGGAGATATTAGAGAGG - Intergenic
989360639 5:40597731-40597753 TTGCAGAGGAGAAAAGAGCAAGG + Intergenic
990016256 5:51065701-51065723 ATGGAAAGGAGAAAAAAGCAGGG + Intergenic
990176545 5:53114478-53114500 AAGGAGAGCAGAAAAGGGGATGG + Intergenic
990398046 5:55404749-55404771 ATGGAGAGAGGTAAGGAGGAAGG - Intronic
991448604 5:66727502-66727524 GTGGAGGGGAGAGAGGAGGAGGG + Intronic
991480852 5:67077550-67077572 ATGGTGAGGAGCAAAGTGGATGG - Intronic
991544636 5:67767810-67767832 ATAGAGATGATAAATGGGGATGG + Intergenic
992017929 5:72594668-72594690 AGGGAGTGAGGAAATGAGGAAGG - Intergenic
992068985 5:73132358-73132380 AAGAAGAGGAGAAAAGAGGAGGG - Intergenic
992083721 5:73259384-73259406 CTGGAGAGGAGAGATGCTGAGGG + Intergenic
992321704 5:75619785-75619807 AAGGAGTGAAGAAAGGAGGAAGG - Intronic
992333986 5:75746432-75746454 ATGGTGAGGAGATATGAGCGGGG + Intergenic
992368450 5:76116988-76117010 ATGGAGAGGAAAAGTGAGCTAGG + Intronic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
992531002 5:77651683-77651705 TTGGAGAGGAGATGTCAGGAAGG - Intergenic
992540585 5:77760379-77760401 AAGGAAAGGAAAAAGGAGGAAGG - Intronic
992592696 5:78311668-78311690 ATGGAGTGGTGAAATGTGGGGGG - Intergenic
993322468 5:86489069-86489091 ATGGAGAGGAGAATGAGGGAGGG + Intergenic
993355690 5:86904423-86904445 ATGGAGAAGAGAGGTGATGAAGG - Intergenic
993418887 5:87674881-87674903 CTGGATAGGAGAAAGGAGAAAGG - Intergenic
993462430 5:88200173-88200195 ATGGAGGTAAGAAATGGGGATGG + Intronic
993539827 5:89135090-89135112 ATGGGGAGTACAAATGAGCATGG - Intergenic
994102493 5:95909115-95909137 ATGGAGAAGACAAATAAGGGAGG + Intronic
994329187 5:98486352-98486374 AGGGAGATAAGAAAGGAGGATGG - Intergenic
994749698 5:103722328-103722350 ATGGAGATGAGAAATGTGTTGGG - Intergenic
994864881 5:105255065-105255087 AGGGAGAGGGGAAAGGAGGGAGG + Intergenic
994867220 5:105290921-105290943 ATGGAGAAAAGAAATGTAGATGG - Intergenic
995121131 5:108536202-108536224 ATGGAGAGCTGGAAAGAGGATGG - Intergenic
995368885 5:111396042-111396064 AAGGAGGGAAGAAAAGAGGAAGG + Intronic
995445976 5:112244447-112244469 ATAGAGAGAAGAAAGGAGGGAGG + Intronic
995650271 5:114361750-114361772 AGGGGGAGGAGAAAAGAGAAAGG - Intronic
995661318 5:114486437-114486459 ATGGATGGGACAAATGAGAAGGG - Intronic
996277825 5:121689043-121689065 ATGAAGAGCAAAAATGGGGAAGG + Intergenic
996391851 5:122970858-122970880 ACAGAGATGAGAAAAGAGGAGGG - Intronic
996847908 5:127921038-127921060 AAGGAAAGGAGGAAGGAGGAAGG + Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997153296 5:131523594-131523616 ATGGAGAGGAAAAAAGGTGAAGG + Intronic
997248553 5:132371410-132371432 AAGGGGATGAGAAATGAGAAAGG - Intronic
997780405 5:136652272-136652294 GTGGAGAGGGGATATGAGGGTGG + Intergenic
998079384 5:139261959-139261981 AGGGAGGGAAGAAATGAGGAAGG + Intronic
998297306 5:140984074-140984096 ATGGAGTGAAGAAATGATGGAGG + Intronic
998394686 5:141811298-141811320 GTGGAGATGAGAAATTGGGATGG - Intergenic
998640282 5:144002593-144002615 ATTGAGAGGAGAGATTTGGAGGG - Intergenic
999265218 5:150262537-150262559 ATGTGCAGGAGAAGTGAGGATGG - Intronic
999541363 5:152576023-152576045 ATGGTGAGGAGGAATGGGAAGGG + Intergenic
999860494 5:155640510-155640532 AAGGGGAAGAGAAAAGAGGAAGG - Intergenic
999968364 5:156833877-156833899 AGGGCTAGGAGAAAGGAGGAAGG + Intergenic
999990390 5:157044529-157044551 AAGGAAAGAAGAAAGGAGGAAGG + Intronic
1000209803 5:159098599-159098621 ATGGAGAGAGGAAGGGAGGAAGG + Intronic
1000373997 5:160562475-160562497 ATGGAGATGAAAAGAGAGGAAGG - Intergenic
1000506679 5:162128594-162128616 AGGGAGAGGAGAGGAGAGGAAGG - Intronic
1000932708 5:167271195-167271217 ATGGTGAGGAGGAGTGGGGAGGG + Intergenic
1001053215 5:168428978-168429000 ACAGATAGGAGAAATGAGGTTGG + Intronic
1001196627 5:169678920-169678942 ATGGAGAAGAGAAACTCGGAGGG + Intronic
1001204568 5:169750170-169750192 ATGGAGAGAAGAATGGAAGAGGG + Intronic
1001337784 5:170814787-170814809 ATGAAAGGGAGAAATGAGGGTGG + Intergenic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001637594 5:173223135-173223157 ATGGGCAGGAGAAATGAACAGGG - Intergenic
1001685303 5:173590238-173590260 AAGGAAAAGAGAAAAGAGGAAGG + Intergenic
1002283717 5:178148558-178148580 TTGGCCAGGAGAAATGAGAAGGG - Exonic
1002460356 5:179370237-179370259 ATGGATAGAAGAAATGAGAAGGG - Intergenic
1002624479 5:180515601-180515623 TTGAAGTTGAGAAATGAGGAGGG + Intronic
1002652481 5:180710354-180710376 AGGATGAGGAAAAATGAGGAAGG + Intergenic
1002742628 5:181444766-181444788 ATGGAGAGGAGAAAGGAGAGGGG + Intergenic
1002742642 5:181444815-181444837 ATAGAGAGGAGAAAGGAGAGGGG + Intergenic
1002742662 5:181444887-181444909 ATGGAGAGGAGAAAGGAGACGGG + Intergenic
1002953747 6:1841947-1841969 ATCCAGAGAAGATATGAGGAAGG - Intronic
1003277534 6:4665221-4665243 ATGGTGAGTAGAAAGGGGGAAGG - Intergenic
1003277705 6:4666548-4666570 ATGGAGAGGACAGGTCAGGAAGG - Intergenic
1003431996 6:6047492-6047514 ATGGAGAGACTAAATGAGAAGGG + Intergenic
1003460080 6:6320867-6320889 ATGGGGAGGAGAAGTGGGAATGG - Intronic
1003465954 6:6380210-6380232 AGGGAGAGGAGGAGGGAGGAAGG - Intergenic
1003737770 6:8896814-8896836 AGAGAGAGGAAAAAAGAGGAAGG - Intergenic
1003961167 6:11210792-11210814 ATAGAAAAGAGAAGTGAGGAAGG + Intronic
1004100804 6:12608996-12609018 CTGGAGAAGAGAAATGGGGTTGG + Intergenic
1004114262 6:12750424-12750446 AAGGAGAGAAGAAATGAGAAGGG + Intronic
1004131177 6:12921538-12921560 AGGGAAAGGAGGAAGGAGGAAGG + Intronic
1004321933 6:14638735-14638757 GTGGGGAGCAGAAAAGAGGAAGG - Intergenic
1004500502 6:16205822-16205844 AGGGAGAGGAGAAGAGGGGATGG - Intergenic
1004622948 6:17347264-17347286 TGGGAGATGAGAAGTGAGGATGG - Intergenic
1004637095 6:17479478-17479500 AAGAAGAGGAGAAGGGAGGACGG + Intronic
1004764065 6:18704628-18704650 ATGGAGGGGAGAAAGCGGGAAGG - Intergenic
1005415219 6:25593205-25593227 ATGAAGTGGAGAAGTGAGAATGG - Intronic
1005825266 6:29628264-29628286 GAGGGGAGGAGAAATGGGGACGG + Intronic
1006284098 6:33080189-33080211 ATGGAAAAGAGAAAGAAGGAAGG + Intronic
1006402520 6:33826085-33826107 AAGGAGAGGTGAAGGGAGGAGGG - Intergenic
1006452585 6:34113697-34113719 AGTGAGAGGAGAAGGGAGGAAGG + Intronic
1006609444 6:35285040-35285062 AGGAAGAAGAGAAATGAGAAAGG - Intronic
1006813625 6:36836876-36836898 TTGGTGGGGAGAGATGAGGAGGG - Intronic
1006911438 6:37566094-37566116 ATGGAGCGGAGAGACGGGGAGGG - Intergenic
1006935368 6:37713556-37713578 ATCCAGGGGAGAAATGAGTAGGG - Intergenic
1007038278 6:38698337-38698359 ATGGAAAGGAGGAAGGAAGAAGG - Intronic
1007082921 6:39121403-39121425 AGGAAGAGGAGAAATCAGGTTGG - Intergenic
1007122429 6:39394426-39394448 AGGGATAGGGGAAATAAGGAGGG + Intronic
1007130303 6:39466233-39466255 AAGGAGAGAAGGAAGGAGGAAGG - Intronic
1007195887 6:40059947-40059969 AGGGAGAGGAGAAAAGATAATGG + Intergenic
1007236857 6:40396643-40396665 ATGAAGAGCAGAAAGGCGGAAGG + Intronic
1007300447 6:40864081-40864103 AGGAAGAGGAGAAATCAGGCTGG + Intergenic
1007436508 6:41816517-41816539 ATTGAGAAGAGAGCTGAGGATGG - Intronic
1007593716 6:43038730-43038752 AAGGAGTGGAGAGAAGAGGATGG + Intronic
1007601338 6:43083544-43083566 ATGCAGAGAAGAAAAGAGGATGG - Intronic
1007995812 6:46306497-46306519 ATGGTAAGGAGAGATGAGGAGGG + Intronic
1008047984 6:46871391-46871413 TGGGAGAGGAGGAATGAGGAAGG + Intronic
1008200392 6:48580769-48580791 ATTTAGAGAAAAAATGAGGAAGG + Intergenic
1008378872 6:50820854-50820876 AGGGAGAGAAGAAAGGAGGGAGG + Intronic
1008501295 6:52185623-52185645 AAGGAGAGGAGACATGATGGGGG - Intergenic
1008521690 6:52367726-52367748 GTGTAGAGGAAAGATGAGGATGG + Intronic
1008819019 6:55608921-55608943 ACGGAGAGGAGAGAAGAGCAAGG + Intergenic
1008874965 6:56315650-56315672 AGGGAGAGGAGGAAGGAAGAGGG - Intronic
1008916795 6:56796777-56796799 AGGGAGAGAAGGAAGGAGGAAGG + Intronic
1009220273 6:60975354-60975376 ATGGAAAACAGAAATTAGGAAGG - Intergenic
1009435852 6:63617807-63617829 ATGAAGAGCAAAAATGAAGATGG - Intergenic
1009537978 6:64914485-64914507 AAGGAGGGGAGCAAAGAGGAAGG + Intronic
1009602008 6:65813219-65813241 GGGGAGAGGATAAAGGAGGAGGG + Intergenic
1009697963 6:67134196-67134218 AGGGAGAGGAGAAAGGGGGTAGG + Intergenic
1010108417 6:72195203-72195225 ATGGAGAAGATAAAGAAGGAAGG - Intronic
1010286153 6:74080475-74080497 ATGGAGAGGAAAAATCAATATGG - Intergenic
1010813532 6:80327892-80327914 AGGGAGGGGAGAAAAGGGGAGGG - Intronic
1011160832 6:84388640-84388662 TTGGAGAGGATGAATTAGGAGGG + Intergenic
1012055068 6:94395752-94395774 AAGGAGAGGAGGAAGGAGGAGGG + Intergenic
1012165680 6:95948102-95948124 AGGAGGAGGAGAAAGGAGGAAGG + Intergenic
1012690572 6:102306429-102306451 ATGGATAGGGGAATTGGGGATGG + Intergenic
1013731510 6:113173577-113173599 AAGGAGAGTAGACATGAAGAGGG + Intergenic
1013854160 6:114551907-114551929 ATGGAGAGAAGAAAAGAGATAGG - Intergenic
1014724003 6:124954260-124954282 AGAGAGAGGAGAAGGGAGGAAGG - Intergenic
1014761175 6:125358348-125358370 AAGGAGGGAACAAATGAGGAAGG - Intergenic
1014849187 6:126320108-126320130 AGAGAGAGGAGAAAGGCGGACGG - Intergenic
1014908555 6:127061098-127061120 AGGGAGAGGAAAAATGGGTAAGG + Intergenic
1015333395 6:132007047-132007069 AAGGAGTGGACTAATGAGGACGG - Intergenic
1015357562 6:132297010-132297032 ATGGAAAGGAAAAAGGAGGGAGG + Exonic
1015577805 6:134691177-134691199 AGGAAGAGGAGAAAGAAGGAGGG + Intergenic
1015809123 6:137143490-137143512 ATCCAGAGGAGAAATGATGGTGG + Intergenic
1016012744 6:139155424-139155446 ATGTAGGGGAAAAATGAGGTAGG + Intronic
1016117424 6:140303973-140303995 ATGGACAGGAGACAGGAGGCAGG - Intergenic
1016689651 6:146922294-146922316 AATGAGATGAGAGATGAGGAGGG + Intergenic
1016764116 6:147773387-147773409 GTACAGAGGAGAAAAGAGGATGG + Intergenic
1017195002 6:151690596-151690618 ATGGGCAGGAGAAAGGAGCATGG - Exonic
1017225189 6:152013202-152013224 AAAGAGAGGAGAAATGAGATAGG - Intronic
1017379052 6:153806185-153806207 ATGAAAAGGATAAATTAGGAGGG + Intergenic
1017669976 6:156761762-156761784 AAGGAAAGAAGAAAGGAGGAAGG + Intergenic
1018365610 6:163116990-163117012 AGGGAGTGGAGAAATGATGCTGG - Intronic
1018496319 6:164348967-164348989 ATGGAGAGGAAACACTAGGAGGG - Intergenic
1018816797 6:167338939-167338961 AGGGAGAGCAGGAAGGAGGAAGG - Intronic
1019046025 6:169146866-169146888 ATGGAGAGGGGAAAGGACAAGGG - Intergenic
1019247504 6:170718817-170718839 GGGGAGAGGAGAGATAAGGAGGG + Intergenic
1019247763 6:170720505-170720527 ATGGAGAGGAGAAAGGAGAGGGG + Intergenic
1019247777 6:170720554-170720576 ATAGAGAGGAGAAAGGAGAGGGG + Intergenic
1019247797 6:170720626-170720648 ATGGAGAGGAGAAAGGAGACGGG + Intergenic
1019320699 7:414186-414208 AGGGAGAGGATCAAGGAGGAGGG - Intergenic
1019320733 7:414264-414286 AGGGAGAGGATCAAGGAGGAGGG - Intergenic
1019376960 7:697872-697894 AAGGAAAGGAGAAAAGAGAAGGG + Intronic
1019410707 7:905369-905391 AGGGAAAGGAGAAAGGAGAAAGG + Intronic
1019410722 7:905454-905476 AGGGAAAGGAGAAAGGAGAAAGG + Intronic
1019410727 7:905474-905496 AGGGAAAGGAGAAAGGAGAAGGG + Intronic
1019410763 7:905646-905668 AGGGAAAGGAGAAAGGAGAAAGG + Intronic
1019410768 7:905673-905695 AGGGAAAGGAGAAAGGAGAAAGG + Intronic
1019410832 7:905981-906003 AGGGAAAGGAGAAAGGAGAAAGG + Intronic
1019410838 7:906015-906037 AGGGAAAGGAGAAAGGAGAAAGG + Intronic
1019410842 7:906035-906057 AGGGAAAGGAGAAAGGAGAAAGG + Intronic
1019410865 7:906150-906172 AGGGAAAGGAGAAAGGAGAAAGG + Intronic
1019410870 7:906177-906199 AGGGAAAGGAGAAAGGAGAAAGG + Intronic
1019410892 7:906291-906313 AGGGAAAGGAGAAAGGAGAAAGG + Intronic
1019410898 7:906325-906347 AGGGAAAGGAGAAAGGAGAAAGG + Intronic
1019410916 7:906421-906443 AGGGAAAGGAGAAAGGAGAAAGG + Intronic
1019410922 7:906455-906477 AGGGAAAGGAGAAAGGAGAAAGG + Intronic
1019410936 7:906524-906546 AGGGAAAGGAGAAAGGAGAAGGG + Intronic
1019410946 7:906572-906594 AGGGAAAGGAGAAAGGAGAAAGG + Intronic
1019410955 7:906614-906636 AGGGAAAGGAGAAAGGAGAAAGG + Intronic
1019474897 7:1239676-1239698 TTGGAGATGAGAAATGGAGATGG - Intergenic
1019805036 7:3117509-3117531 GGGGAGAGGAGAGATGAGAAAGG + Intergenic
1019897479 7:3994002-3994024 ATAGAGAGGAGAAAATAAGAAGG - Intronic
1020362593 7:7344970-7344992 ATGGACAGGAGAAATGAGTTTGG + Intergenic
1020800922 7:12731201-12731223 GAGGAGACGAGGAATGAGGAGGG - Intergenic
1021132503 7:16928191-16928213 TTAGAGAGGAAAAATGATGATGG - Intergenic
1021243997 7:18239394-18239416 ATGGAGAGGAGATAGGAGAGAGG + Intronic
1022061349 7:26799024-26799046 AAGGGGAGGGGAAAAGAGGAGGG + Intronic
1022096161 7:27142878-27142900 AAGAAGAGGAGGAAGGAGGAAGG + Intronic
1022096966 7:27147261-27147283 AGGGAGAGGGGAAAGGAGGCAGG - Intronic
1022218731 7:28291058-28291080 ATGGAAAGAAGAAATGAGGCTGG - Intergenic
1022317321 7:29257482-29257504 GTGGAAAGGAGAAAAGATGAAGG - Intronic
1022332311 7:29391387-29391409 AGGGAGGGGAGAAGAGAGGAAGG + Intronic
1022374671 7:29802432-29802454 ATGGAGGGGAGGACTGAGAAAGG + Intergenic
1022536178 7:31100037-31100059 AGGGAAAGCAGAAAAGAGGAGGG - Intronic
1022574805 7:31487306-31487328 AAGGACAGGAGGAAGGAGGAAGG - Intergenic
1023075475 7:36478019-36478041 ATAGAGAAGAGAAAGAAGGAAGG - Intergenic
1023122802 7:36926210-36926232 AAGCAGAGTAGAGATGAGGATGG - Intronic
1023198397 7:37666795-37666817 AGGGTGAGGAGAGAAGAGGAAGG - Intergenic
1023241390 7:38151402-38151424 ATGGGGAGGAAATGTGAGGACGG - Intergenic
1023381502 7:39612821-39612843 TTGGAAAGGAGATATGATGATGG + Intergenic
1023569753 7:41559660-41559682 AGGGCGAGGAAAAATGAGGTTGG - Intergenic
1023883288 7:44333853-44333875 AGGGAGGGGAGAAATCAGGGTGG - Intronic
1024028339 7:45433260-45433282 AAGCAGAGGAGAGAGGAGGAAGG + Intergenic
1024157237 7:46638189-46638211 CTGGAGAGGGGCTATGAGGATGG - Intergenic
1024525296 7:50343271-50343293 ATGGAGAAAAGAAGAGAGGAAGG - Intronic
1024610309 7:51058722-51058744 ATGGAGAGGCGTGATGAGGCAGG + Intronic
1024701888 7:51912331-51912353 AATGAGAGGAGAAATGATGCTGG - Intergenic
1024771184 7:52725082-52725104 AGCGAGAGAAGAAATGAGGAAGG + Intergenic
1024960768 7:54972184-54972206 AGGGAGAGGAAAAATGAGATTGG - Intergenic
1025014188 7:55425613-55425635 ATGGAGAGGACAAATGTCAATGG + Intronic
1025095081 7:56090415-56090437 ATGGATAGAATACATGAGGAAGG - Intronic
1026184100 7:68068181-68068203 TTGGAGAGTAGAGAAGAGGAAGG + Intergenic
1026671913 7:72398108-72398130 AAGAAGAGGAGAAATAAAGATGG + Intronic
1026680224 7:72461027-72461049 ATGGAGAGAAGGAAGGAGGAAGG - Intergenic
1026877984 7:73890625-73890647 GTGGAGAGGAGACGGGAGGAAGG - Intergenic
1027303946 7:76872525-76872547 ATGCAGATGAGAGATGAGGAAGG + Intergenic
1027306430 7:76902598-76902620 TTGCAGAGGAGAAATGAGAATGG + Intergenic
1027675462 7:81152515-81152537 AGGGAAAGGAGAGAAGAGGAGGG + Intergenic
1027764159 7:82318574-82318596 ATGGAGAGAACAAAGGAGAAGGG - Intronic
1027977516 7:85178445-85178467 ATGGAGATGAGAAATGTGTTGGG + Intronic
1028741824 7:94284097-94284119 ATGGAGTAGAGAAATGAAAATGG - Intergenic
1029073892 7:97921038-97921060 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1029578307 7:101418845-101418867 GTGGAGAGGAGGAAAGAGGAAGG - Intronic
1029655888 7:101924156-101924178 ATGGGGAGGAGGACAGAGGATGG + Intronic
1029959186 7:104671307-104671329 AAGGAGAGTAGACATGAAGAGGG - Intronic
1030085982 7:105816095-105816117 ATGGGGAGGAGAAGTGAGGGTGG + Intronic
1030168627 7:106579577-106579599 ATGGAACTGAGAAATGAGAAAGG + Intergenic
1030318640 7:108141728-108141750 CTGGAGAGCAAAAATGAGGGTGG + Intergenic
1030564879 7:111141305-111141327 ATTGGGAGGGGAAATGTGGAGGG - Intronic
1030582985 7:111383423-111383445 AAGCAGAGTAGAGATGAGGATGG - Intronic
1030944519 7:115700346-115700368 GAGGAGAGGAGACAAGAGGAAGG - Intergenic
1031092077 7:117370038-117370060 ATGGTGAGGAGACATGCGGGTGG + Intronic
1031446342 7:121859567-121859589 AAGGAGAGGAGAAATAAATATGG - Intergenic
1031538760 7:122967119-122967141 ATAGAGAGGAGAAAAGGAGAGGG - Intergenic
1031682862 7:124695742-124695764 GAGGAGAGGAGAAAAGAGAAAGG + Intergenic
1031866615 7:127044048-127044070 AGGGAGAGGTGAACAGAGGAAGG + Intronic
1031889840 7:127281409-127281431 AAGAAGAGAAGAAATGAGAATGG - Intergenic
1031955395 7:127937445-127937467 AGGGAGAGGAGAAGGGAGAAGGG - Intronic
1032491406 7:132327043-132327065 AGGGAGAGAAGAAAGGAGGGAGG + Intronic
1032491411 7:132327063-132327085 AGGGAGAGAAGAAAGGAGGGAGG + Intronic
1032523310 7:132562086-132562108 AGGAGGAGGAGAAAGGAGGAGGG - Intronic
1032696943 7:134345235-134345257 AGGGAGAGGAGTAAAGAGAATGG + Intergenic
1032841188 7:135714645-135714667 ATGGCGAGGAGAGATGGGAAAGG + Intronic
1033018986 7:137702610-137702632 ATGGAGCTGAGAGATAAGGATGG - Intronic
1033077241 7:138261036-138261058 ATGGAGAGGTTAAATAATGAAGG + Intergenic
1033391850 7:140936373-140936395 ATGGAGAGGAGAAGTCAACAGGG + Intergenic
1033849018 7:145471829-145471851 ATGGAGAGGAGATGAAAGGAGGG - Intergenic
1034385588 7:150738117-150738139 TGGGACAGGAGAAATTAGGAGGG - Intronic
1034391528 7:150791404-150791426 GTGGGGAGAAGAAAGGAGGAGGG + Exonic
1034432629 7:151048761-151048783 AAGGAGAGGAGAAGAGAGGGTGG - Intronic
1034908398 7:154971464-154971486 ATGGAGAGGAGAAATCTGCAAGG + Intronic
1035333042 7:158108529-158108551 ATGGACAGGAAAGATGTGGAGGG - Intronic
1035500320 8:87238-87260 ATGGAGAGGAGAAAGGAGACGGG - Intergenic
1035500341 8:87309-87331 ATGGAGAGGAGAAAGAAGAGGGG - Intergenic
1035500359 8:87382-87404 ATAGAGAGGAGAAAGGAGAGGGG - Intergenic
1035500373 8:87431-87453 ATGGAGAGGAGAAAGGAGAGGGG - Intergenic
1035500633 8:89119-89141 GGGGAGAGGAGAGATAAGGAGGG - Intergenic
1035702694 8:1648723-1648745 AGGGAGAGGAGGAAAGAGGCCGG - Intronic
1035743593 8:1946177-1946199 ATGGAGGAAAGAAATGAGGAGGG + Intronic
1035873071 8:3156816-3156838 ATGGAGACGATAATTTAGGAGGG + Intronic
1036126600 8:6068630-6068652 AAGGAGAGGAGAAGGAAGGAAGG - Intergenic
1036130398 8:6104263-6104285 ATGGAGAGGAGGGGAGAGGAAGG + Intergenic
1036187548 8:6637297-6637319 ATAGAGAGGAGGAGTGAGGTAGG + Intronic
1036223456 8:6939758-6939780 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036236327 8:7042501-7042523 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036243813 8:7100258-7100280 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1036256976 8:7213793-7213815 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036276816 8:7359910-7359932 ATGGAGATGAGATATCAGGCAGG + Intronic
1036309026 8:7672392-7672414 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036360508 8:8073720-8073742 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1036651603 8:10647485-10647507 GGGGAGAGGAGAAATGAGGATGG - Intronic
1036664230 8:10728699-10728721 ATGGGGAGGAGAGAGGAGCATGG - Intronic
1036890463 8:12593247-12593269 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036898031 8:12651165-12651187 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1037039517 8:14213110-14213132 AAGGAGAGGAGTAAGAAGGAGGG + Intronic
1037774415 8:21823437-21823459 AAGGAGAGAAGAAAGAAGGAGGG - Intergenic
1038348890 8:26758427-26758449 TTTGAGAGGGGAAATGAAGATGG + Intronic
1038547685 8:28438379-28438401 AAGAAGAAGAGAAATGGGGACGG + Intronic
1038644698 8:29351876-29351898 ATGCAAAAGAGAAATGGGGATGG - Intergenic
1038693779 8:29786749-29786771 ATGGTGAGCAAAAATGAGCATGG - Intergenic
1038896888 8:31793882-31793904 ATGGAGAGATGGAAGGAGGAAGG - Intronic
1039104028 8:33970915-33970937 ATGGACAGGAGGCATGAGGGTGG - Intergenic
1039224807 8:35376953-35376975 AAGGAAAGCAGAAAAGAGGAAGG - Intronic
1039226213 8:35391278-35391300 CTGGAGCTGAGAAATGATGATGG - Intronic
1039365760 8:36926419-36926441 ATGGAGGGGAGAGATGTGGGTGG - Intronic
1039598527 8:38812752-38812774 ATGAAGGGGAAAAATGAGGATGG - Intronic
1039657355 8:39424079-39424101 ATGGAGATGAGAAATGTGTTGGG - Intergenic
1039727788 8:40238490-40238512 AGGGAGAGAAGGAATGAGGGAGG - Intergenic
1040654367 8:49488443-49488465 AGGGAGAGAAGAAAGAAGGAAGG + Intergenic
1041010715 8:53540091-53540113 GGGGAGAGAGGAAATGAGGAAGG + Intergenic
1041151691 8:54942446-54942468 ATGGTGAGAAGAAACGTGGAGGG - Intergenic
1041453372 8:58031844-58031866 AGGGAGAGAAGAAAGAAGGAAGG - Intronic
1041543090 8:59009109-59009131 AGGGAGAGAAGAAAGTAGGATGG - Intronic
1041568001 8:59302712-59302734 AAGGGGAGAAGAAATGGGGAAGG + Intergenic
1042031145 8:64477299-64477321 ATGGAGAGCAGAAAAGAGACTGG + Intergenic
1042155122 8:65836896-65836918 AGGGGGAGGAGGAAGGAGGATGG - Intronic
1042555816 8:70033116-70033138 AGGGAGAGGAGAAAGGAGGAAGG + Intergenic
1042594839 8:70435991-70436013 ATGGAGAGGAAAAACGATCATGG - Intergenic
1042622133 8:70718000-70718022 ATGGAGATGAGGAATTTGGAGGG - Intronic
1042712241 8:71731080-71731102 AAGGCTAGGAAAAATGAGGAAGG - Intergenic
1043544726 8:81302419-81302441 ATGGAGAGGTGGGTTGAGGAGGG - Intergenic
1043708506 8:83382442-83382464 AAGGAAAGGAGAAAGGAGAAAGG + Intergenic
1044044370 8:87412791-87412813 AAGAAGAGGAGAAAAGAGGGAGG + Intronic
1044648811 8:94473585-94473607 TCGGAGAGTAGAAATGATGAAGG + Intronic
1045025579 8:98083627-98083649 GTGAGGAGGGGAAATGAGGAGGG - Intronic
1045272086 8:100670660-100670682 GTGGAGAGGGGACATGAGGGTGG - Intergenic
1045345753 8:101292091-101292113 ATGGAGCAGAGACAAGAGGATGG + Intergenic
1045487163 8:102640564-102640586 AGGGAGAGAAGGAAAGAGGAAGG + Intergenic
1045635474 8:104182523-104182545 ATGAATGGGTGAAATGAGGAGGG - Intronic
1046075339 8:109305858-109305880 AGGAAGAGGAGAAATCAGGCTGG - Intronic
1046120558 8:109841171-109841193 AAGGAGAGGAGATTTGAAGAGGG - Intergenic
1046126094 8:109910281-109910303 AAGGAGAGGAGAGGAGAGGAGGG - Intergenic
1046173945 8:110550103-110550125 AGGGAGAGGAGAAAGAAGGTTGG + Intergenic
1046974026 8:120253358-120253380 AGGGAGCAGAGAAAAGAGGATGG - Intronic
1047678016 8:127224074-127224096 AGGGAGAGTAGAAATGAGGCTGG - Intergenic
1047767766 8:128003274-128003296 GAGGAGAGGAGAAGAGAGGAAGG - Intergenic
1047994192 8:130317896-130317918 GTGGAGAGGAGAGCTGAGGAAGG + Intronic
1048080840 8:131124584-131124606 ATGGAGAGGACACGTGTGGATGG + Intergenic
1048413005 8:134195220-134195242 AGGGAGGGAAGAAAGGAGGAAGG - Intergenic
1048748365 8:137642104-137642126 AGAAAGAGGATAAATGAGGAAGG - Intergenic
1048754797 8:137727159-137727181 AAGGAGAGGAGAGGAGAGGAGGG + Intergenic
1048761256 8:137798146-137798168 ATGGGGAGGAGATATGATGAAGG + Intergenic
1048859618 8:138714408-138714430 ATGGAGAGGACAGAGAAGGACGG + Intronic
1049266107 8:141668681-141668703 AGGGCGAGCAGAAGTGAGGAAGG + Intergenic
1049288270 8:141788289-141788311 AGGGAGAGGAGAGCTGAGCAGGG - Intergenic
1049904431 9:202880-202902 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1050114206 9:2246456-2246478 ATGGAAAGAAGAATGGAGGAAGG + Intergenic
1050132652 9:2428723-2428745 ATGGAGAGGAGAGAAGGGGAAGG + Intergenic
1050407616 9:5326871-5326893 ATTGATAACAGAAATGAGGAAGG + Intergenic
1051400778 9:16679726-16679748 ATGGAGAGGAAAAGGCAGGAAGG + Intronic
1051432046 9:16989325-16989347 ATGATGAAGAGGAATGAGGAAGG - Intergenic
1051475467 9:17503415-17503437 GTGAAGAGGTGAAATGAGGTGGG - Exonic
1051833122 9:21303430-21303452 ATGGAGGGGGGAAATAAGGTTGG - Intergenic
1052141092 9:24984929-24984951 ATGGAGAAGGGAAAGGAGAAAGG + Intergenic
1053452120 9:38202206-38202228 TTGGAGAGGAGAATGGAGGCAGG + Intergenic
1053531654 9:38888019-38888041 ATTGAGAGGAGAAAGGACGCAGG + Intergenic
1053727003 9:41014454-41014476 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1054203878 9:62112447-62112469 ATTGAGAGGAGAAAGGACGCAGG + Intergenic
1054634484 9:67475918-67475940 ATTGAGAGGAGAAAGGACGCAGG - Intergenic
1054720597 9:68599905-68599927 ATGAAGAGGAGAGAGGAGGATGG - Intergenic
1055515010 9:77024733-77024755 ACGAAGAGAAGCAATGAGGAAGG + Intergenic
1055664890 9:78543497-78543519 AGGGAGAAGAGAAATGAAGCGGG - Intergenic
1055731316 9:79281861-79281883 AGAGAGAGAAGAAATGAGAAAGG + Intergenic
1055819321 9:80242814-80242836 ATGGAGAGAAGGAAGGAGGTAGG - Intergenic
1056182618 9:84100603-84100625 AATGAGAGGAGAACTGAGAATGG - Intergenic
1056310943 9:85340196-85340218 ATGGAGAGAAGAAAGGAGAGGGG - Intergenic
1056523180 9:87418861-87418883 AGGGAGAAGAGAACTGAGCAAGG - Intergenic
1056527647 9:87458083-87458105 ATGGAGATGAGAAGTAAAGAAGG + Intergenic
1057006306 9:91563702-91563724 AGGGAGAGAAGAAAGAAGGAAGG + Intronic
1057077642 9:92147287-92147309 AGGGAGAGAAGGAAGGAGGAAGG - Intergenic
1057820914 9:98329826-98329848 GAGGAGAGGAGAGATGGGGAGGG - Intronic
1058028642 9:100171038-100171060 GTGGAGAGGAGAAAAGAGAGAGG + Intronic
1058049239 9:100390048-100390070 ATATAGAGGAGAGAAGAGGAAGG + Intergenic
1058149192 9:101445327-101445349 ATGAGGAGGAGAGATGAGAAAGG - Intergenic
1058204024 9:102079534-102079556 ATAGAGAGGATAAATAAAGAGGG - Intergenic
1058280166 9:103103811-103103833 ATGGAGAGAAGACCTGAGGTAGG - Intergenic
1058524493 9:105843573-105843595 ATGGTGTGGAGAAATGTAGACGG + Intergenic
1058527308 9:105872900-105872922 AAAGAGAGAAGAAAGGAGGAAGG - Intergenic
1058561425 9:106233098-106233120 AGGAGGAGGAGAAAAGAGGAAGG - Intergenic
1058606351 9:106727774-106727796 CTCCTGAGGAGAAATGAGGAAGG - Intergenic
1058961424 9:109995900-109995922 ATGGAGAGGAAGGATGAGGCAGG + Intronic
1059209756 9:112502089-112502111 CTGGTGAGTAGAAAGGAGGAGGG + Intronic
1059443903 9:114326325-114326347 AAGGAGAGGAAACAGGAGGAGGG + Exonic
1059445110 9:114333102-114333124 AAGGAGAGGAAACAGGAGGAGGG + Exonic
1059450197 9:114366733-114366755 AGGGAGAGGAGAGGAGAGGAGGG + Intronic
1059561472 9:115338830-115338852 AAGGAGAAGGGAAATGTGGAAGG - Intronic
1059909294 9:119024660-119024682 AGGGAGAGGAGAAAAGATGAGGG - Intergenic
1060240371 9:121897877-121897899 AAGGAGAGGAGAAAAGAGAAGGG - Intronic
1060816733 9:126639075-126639097 TTGGAGAGGAGAGAAGAGGCTGG + Intronic
1061257317 9:129460347-129460369 ATGGAGAGGAGGAGGGAGGGAGG - Intergenic
1061282006 9:129602834-129602856 AGGGAGGGGAGAGATGAGGGAGG + Intergenic
1061660334 9:132125903-132125925 ATGGAGAAGAGAACACAGGAGGG - Intergenic
1061751607 9:132781936-132781958 ACAGAGATGAGAAAGGAGGAAGG + Intronic
1061942718 9:133891861-133891883 ATGGAGGGGAGGCATGGGGATGG + Intronic
1062182161 9:135196495-135196517 ATGGGAAGGAGAAATGGGAAGGG - Intergenic
1202801404 9_KI270720v1_random:2862-2884 AGGGACATGAGAAATTAGGAAGG + Intergenic
1203608534 Un_KI270748v1:75985-76007 ATGGAGAGGAGAAAGGAGAGGGG + Intergenic
1203608549 Un_KI270748v1:76034-76056 ATAGAGAGGAGAAAGGAGAGGGG + Intergenic
1203608569 Un_KI270748v1:76106-76128 ATGGAGAGGAGAAAGGAGACGGG + Intergenic
1203626721 Un_KI270750v1:32423-32445 ATGGAGGGGAAAAAAGAGGGTGG - Intergenic
1185535113 X:854916-854938 AGGGAATGGAGAAAGGAGGAAGG - Intergenic
1185603709 X:1355285-1355307 AGGGGGAGGAAAAAGGAGGAGGG + Intronic
1185766892 X:2732873-2732895 AGGGAGAGAAGAAAGAAGGAAGG - Intronic
1185873728 X:3685259-3685281 AAGGAAGGGAGAAAGGAGGATGG - Intronic
1186135309 X:6513440-6513462 ATGGAGAGAAGAAGAGAGAAGGG - Intergenic
1186270094 X:7877584-7877606 AGGGAGAGAAGAAAGGAGGGTGG + Intergenic
1186530522 X:10290609-10290631 ATGGACAGAAGAATGGAGGAAGG + Intergenic
1186581497 X:10824706-10824728 ATGTAGAGGAAAAATTACGAAGG + Intronic
1186873787 X:13797522-13797544 ATGGTGGGGAGAAGTCAGGAAGG + Intronic
1186924700 X:14320435-14320457 AAGGAGAAGAGAAACAAGGATGG - Intergenic
1186925387 X:14328283-14328305 CTGGAGAGGGGAAATGTGCAAGG - Intergenic
1187236471 X:17472261-17472283 AAGGGAAGGAGAAATGATGAGGG + Intronic
1187307966 X:18114304-18114326 ATGTAGGCAAGAAATGAGGATGG + Intergenic
1187505368 X:19874681-19874703 AGGGAGAGCAGAAGTGGGGAGGG + Intronic
1187654368 X:21453540-21453562 ATGGAGAGATGAACTGAAGAGGG - Intronic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1188519288 X:31020108-31020130 CTGAAGAGGAGGAATAAGGAGGG + Intergenic
1188714984 X:33449492-33449514 ATGGTGAGGAGATATGGGAATGG - Intergenic
1189000333 X:36937369-36937391 AAGGAGAGGAGAGGAGAGGAGGG + Intergenic
1189011622 X:37050866-37050888 ACAGAGAGGAGAAGAGAGGAAGG + Intergenic
1189038692 X:37519312-37519334 ATAGAGGGGAAAAATGAGAAAGG - Intronic
1189197654 X:39165746-39165768 GTGGGGAGGAGCAGTGAGGAGGG - Intergenic
1189235102 X:39480877-39480899 GTGGAGAGGGGAGATGGGGAAGG + Intergenic
1189314152 X:40041920-40041942 AAGGAGAGGAGAAGGAAGGAGGG + Intergenic
1189352301 X:40284943-40284965 ATGTTGAGGAGAAAGGAGGGTGG - Intergenic
1189585496 X:42456999-42457021 AAGGAGAGAGGAAAAGAGGAGGG - Intergenic
1189988865 X:46576151-46576173 AGGGAGAGGGGAAATGAGAGAGG - Intronic
1190627610 X:52351986-52352008 AAAGAGAGGAGGAAGGAGGAAGG - Intergenic
1190869594 X:54413989-54414011 ATGCAGATGAGAGATGATGATGG + Intergenic
1190927470 X:54922247-54922269 ATGGATAGGAGAAATGACTACGG + Exonic
1190947263 X:55108118-55108140 ATGGAGAGGAGCCCTGAGGCAGG + Intronic
1191091389 X:56626274-56626296 GTGGGGAGAAGAAAAGAGGAGGG + Intergenic
1191904309 X:66072766-66072788 AAGGAGAGTAGACATGAAGATGG + Intergenic
1192050776 X:67722072-67722094 ATGGGGAGGGGGAATGAAGAAGG - Intronic
1192102529 X:68279446-68279468 ATGATGGGGAGAAGTGAGGAAGG - Intronic
1192243871 X:69357624-69357646 AAAGAGAGGAGAAAGGGGGAAGG + Intergenic
1193103521 X:77642377-77642399 ATGCAGAGGAGCAAAGATGAAGG + Intronic
1193289271 X:79752958-79752980 ATGGAAAGGAGAAGTAAGAATGG - Intergenic
1193601538 X:83512572-83512594 ATGGAGAGGAAGAAGAAGGATGG - Intergenic
1193679822 X:84504530-84504552 AGTGAGAGGGGAAAAGAGGAAGG - Intergenic
1193738801 X:85193228-85193250 ATGGGGAGGAAAAATGATGATGG + Intergenic
1193742981 X:85241271-85241293 CTGGAGAGGAGAGAGAAGGAGGG + Intergenic
1194198221 X:90922876-90922898 AAGGAGAGGAGAACAAAGGAAGG - Intergenic
1194619196 X:96147885-96147907 AAGAAAGGGAGAAATGAGGAAGG + Intergenic
1194736982 X:97524050-97524072 ATGGTAAGGAGCAAAGAGGAGGG - Intronic
1195328253 X:103775523-103775545 TGGGAGAGGAGAGAAGAGGAGGG - Intronic
1195412442 X:104582551-104582573 AGAAAGAGGAGAAAGGAGGAAGG - Intronic
1195494249 X:105511520-105511542 ATGGAGAGGACACATGTGGGTGG - Intronic
1195516164 X:105778767-105778789 AGGGAGAGGGGAGAGGAGGAGGG - Intergenic
1195593601 X:106661544-106661566 AAGGAGAGAAGTAATGAAGAAGG + Intronic
1195712711 X:107786982-107787004 AGGGAGAGAAGGAAGGAGGAAGG + Intronic
1195943051 X:110180842-110180864 ATGGAGAAGGGAAGTGTGGAAGG - Intronic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196079650 X:111617891-111617913 AAGGAGAGTAGACATGAAGAGGG + Intergenic
1196135171 X:112200914-112200936 AGGGAAAGGAATAATGAGGAAGG + Intergenic
1196210442 X:112990173-112990195 ATTGATAGGAGAAAGGAGTAAGG - Intergenic
1196346962 X:114674015-114674037 ATGGAGAGTAGAGAAGAGAATGG + Intronic
1196512324 X:116526291-116526313 AAGGAGAGGAGACAGAAGGAGGG + Intergenic
1196756428 X:119161330-119161352 AAAGAGAGGCCAAATGAGGAAGG + Intergenic
1197211203 X:123829689-123829711 ATGGAGGAGAGAAATTGGGATGG - Intergenic
1197605252 X:128578113-128578135 ATACAGAGGAGAGATGATGATGG - Intergenic
1197627170 X:128815154-128815176 AGGGAGAGGAGTAATGAAGTAGG + Intergenic
1197671387 X:129282184-129282206 ATGGAGAGCAAAAGTGAGCAGGG - Intergenic
1197775838 X:130118199-130118221 TTGGAGAGGAGAGATCAGGAGGG + Intergenic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198069581 X:133134840-133134862 AGGGAAAGGAGAAAAGAGAATGG + Intergenic
1198140871 X:133802004-133802026 ATGGCGAACAGAAATGAAGAGGG - Intronic
1198411946 X:136379528-136379550 AAGGAGAGGAGAAGAGAGGGAGG - Intronic
1198960994 X:142183009-142183031 ATGTGGGGGAGAAGTGAGGATGG + Intergenic
1199053101 X:143260779-143260801 TTGGTAAGAAGAAATGAGGAGGG + Intergenic
1199295235 X:146149864-146149886 AAGGAGATGAGAAATGCAGAGGG - Intergenic
1199357654 X:146880654-146880676 ATGGAGAGTAGAAACAAGGCAGG + Intergenic
1199399275 X:147377355-147377377 ATGGAGAGCAGAGAAGAGCAAGG - Intergenic
1199443184 X:147892191-147892213 ATGGACAGAAGAAATAAGAAAGG + Intergenic
1199541851 X:148966448-148966470 ATAGAGAGGAGAGAGGAGGAGGG - Intronic
1199555057 X:149098138-149098160 AAGGAGAGAAGGAAGGAGGAAGG + Intergenic
1199712044 X:150476565-150476587 ATGGGGAGGAGGGATGTGGATGG + Intronic
1200047587 X:153411024-153411046 ATGGTGTGGAGACACGAGGAGGG - Intergenic
1200543516 Y:4489955-4489977 AAGGAGAGGAGAACAAAGGAAGG + Intergenic
1201458971 Y:14201501-14201523 ATGGAGGGAGGAAATAAGGAAGG + Intergenic
1201625684 Y:16012143-16012165 AGGGATGGCAGAAATGAGGAAGG + Intergenic
1202273883 Y:23096218-23096240 AAGGACAGAAGAAATGAGGGAGG + Intergenic
1202292143 Y:23324459-23324481 AAGGACAGAAGAAATGAGGGAGG - Intergenic
1202426879 Y:24729963-24729985 AAGGACAGAAGAAATGAGGGAGG + Intergenic
1202443912 Y:24940131-24940153 AAGGACAGAAGAAATGAGGGAGG - Intergenic