ID: 1075154918

View in Genome Browser
Species Human (GRCh38)
Location 10:119967326-119967348
Sequence TCCTTGGAGAGATGGATTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075154918_1075154927 9 Left 1075154918 10:119967326-119967348 CCTCAAATCCATCTCTCCAAGGA No data
Right 1075154927 10:119967358-119967380 TGGGGTTTTTAAGGAGATTGTGG No data
1075154918_1075154932 20 Left 1075154918 10:119967326-119967348 CCTCAAATCCATCTCTCCAAGGA No data
Right 1075154932 10:119967369-119967391 AGGAGATTGTGGAGGGCAAGGGG No data
1075154918_1075154933 25 Left 1075154918 10:119967326-119967348 CCTCAAATCCATCTCTCCAAGGA No data
Right 1075154933 10:119967374-119967396 ATTGTGGAGGGCAAGGGGCTAGG No data
1075154918_1075154926 0 Left 1075154918 10:119967326-119967348 CCTCAAATCCATCTCTCCAAGGA No data
Right 1075154926 10:119967349-119967371 GTTCTGGGCTGGGGTTTTTAAGG No data
1075154918_1075154928 12 Left 1075154918 10:119967326-119967348 CCTCAAATCCATCTCTCCAAGGA No data
Right 1075154928 10:119967361-119967383 GGTTTTTAAGGAGATTGTGGAGG No data
1075154918_1075154930 18 Left 1075154918 10:119967326-119967348 CCTCAAATCCATCTCTCCAAGGA No data
Right 1075154930 10:119967367-119967389 TAAGGAGATTGTGGAGGGCAAGG No data
1075154918_1075154924 -9 Left 1075154918 10:119967326-119967348 CCTCAAATCCATCTCTCCAAGGA No data
Right 1075154924 10:119967340-119967362 CTCCAAGGAGTTCTGGGCTGGGG No data
1075154918_1075154931 19 Left 1075154918 10:119967326-119967348 CCTCAAATCCATCTCTCCAAGGA No data
Right 1075154931 10:119967368-119967390 AAGGAGATTGTGGAGGGCAAGGG No data
1075154918_1075154929 13 Left 1075154918 10:119967326-119967348 CCTCAAATCCATCTCTCCAAGGA No data
Right 1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG No data
1075154918_1075154923 -10 Left 1075154918 10:119967326-119967348 CCTCAAATCCATCTCTCCAAGGA No data
Right 1075154923 10:119967339-119967361 TCTCCAAGGAGTTCTGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075154918 Original CRISPR TCCTTGGAGAGATGGATTTG AGG (reversed) Intergenic
No off target data available for this crispr