ID: 1075154920

View in Genome Browser
Species Human (GRCh38)
Location 10:119967334-119967356
Sequence CCCAGAACTCCTTGGAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075154920_1075154935 25 Left 1075154920 10:119967334-119967356 CCATCTCTCCAAGGAGTTCTGGG No data
Right 1075154935 10:119967382-119967404 GGGCAAGGGGCTAGGACATTGGG No data
1075154920_1075154936 26 Left 1075154920 10:119967334-119967356 CCATCTCTCCAAGGAGTTCTGGG No data
Right 1075154936 10:119967383-119967405 GGCAAGGGGCTAGGACATTGGGG No data
1075154920_1075154927 1 Left 1075154920 10:119967334-119967356 CCATCTCTCCAAGGAGTTCTGGG No data
Right 1075154927 10:119967358-119967380 TGGGGTTTTTAAGGAGATTGTGG No data
1075154920_1075154932 12 Left 1075154920 10:119967334-119967356 CCATCTCTCCAAGGAGTTCTGGG No data
Right 1075154932 10:119967369-119967391 AGGAGATTGTGGAGGGCAAGGGG No data
1075154920_1075154934 24 Left 1075154920 10:119967334-119967356 CCATCTCTCCAAGGAGTTCTGGG No data
Right 1075154934 10:119967381-119967403 AGGGCAAGGGGCTAGGACATTGG No data
1075154920_1075154933 17 Left 1075154920 10:119967334-119967356 CCATCTCTCCAAGGAGTTCTGGG No data
Right 1075154933 10:119967374-119967396 ATTGTGGAGGGCAAGGGGCTAGG No data
1075154920_1075154931 11 Left 1075154920 10:119967334-119967356 CCATCTCTCCAAGGAGTTCTGGG No data
Right 1075154931 10:119967368-119967390 AAGGAGATTGTGGAGGGCAAGGG No data
1075154920_1075154928 4 Left 1075154920 10:119967334-119967356 CCATCTCTCCAAGGAGTTCTGGG No data
Right 1075154928 10:119967361-119967383 GGTTTTTAAGGAGATTGTGGAGG No data
1075154920_1075154929 5 Left 1075154920 10:119967334-119967356 CCATCTCTCCAAGGAGTTCTGGG No data
Right 1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG No data
1075154920_1075154926 -8 Left 1075154920 10:119967334-119967356 CCATCTCTCCAAGGAGTTCTGGG No data
Right 1075154926 10:119967349-119967371 GTTCTGGGCTGGGGTTTTTAAGG No data
1075154920_1075154930 10 Left 1075154920 10:119967334-119967356 CCATCTCTCCAAGGAGTTCTGGG No data
Right 1075154930 10:119967367-119967389 TAAGGAGATTGTGGAGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075154920 Original CRISPR CCCAGAACTCCTTGGAGAGA TGG (reversed) Intergenic
No off target data available for this crispr