ID: 1075154925

View in Genome Browser
Species Human (GRCh38)
Location 10:119967342-119967364
Sequence AACCCCAGCCCAGAACTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075154925_1075154933 9 Left 1075154925 10:119967342-119967364 CCAAGGAGTTCTGGGCTGGGGTT No data
Right 1075154933 10:119967374-119967396 ATTGTGGAGGGCAAGGGGCTAGG No data
1075154925_1075154932 4 Left 1075154925 10:119967342-119967364 CCAAGGAGTTCTGGGCTGGGGTT No data
Right 1075154932 10:119967369-119967391 AGGAGATTGTGGAGGGCAAGGGG No data
1075154925_1075154927 -7 Left 1075154925 10:119967342-119967364 CCAAGGAGTTCTGGGCTGGGGTT No data
Right 1075154927 10:119967358-119967380 TGGGGTTTTTAAGGAGATTGTGG No data
1075154925_1075154928 -4 Left 1075154925 10:119967342-119967364 CCAAGGAGTTCTGGGCTGGGGTT No data
Right 1075154928 10:119967361-119967383 GGTTTTTAAGGAGATTGTGGAGG No data
1075154925_1075154935 17 Left 1075154925 10:119967342-119967364 CCAAGGAGTTCTGGGCTGGGGTT No data
Right 1075154935 10:119967382-119967404 GGGCAAGGGGCTAGGACATTGGG No data
1075154925_1075154929 -3 Left 1075154925 10:119967342-119967364 CCAAGGAGTTCTGGGCTGGGGTT No data
Right 1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG No data
1075154925_1075154931 3 Left 1075154925 10:119967342-119967364 CCAAGGAGTTCTGGGCTGGGGTT No data
Right 1075154931 10:119967368-119967390 AAGGAGATTGTGGAGGGCAAGGG No data
1075154925_1075154930 2 Left 1075154925 10:119967342-119967364 CCAAGGAGTTCTGGGCTGGGGTT No data
Right 1075154930 10:119967367-119967389 TAAGGAGATTGTGGAGGGCAAGG No data
1075154925_1075154938 30 Left 1075154925 10:119967342-119967364 CCAAGGAGTTCTGGGCTGGGGTT No data
Right 1075154938 10:119967395-119967417 GGACATTGGGGTCATTGATTGGG No data
1075154925_1075154936 18 Left 1075154925 10:119967342-119967364 CCAAGGAGTTCTGGGCTGGGGTT No data
Right 1075154936 10:119967383-119967405 GGCAAGGGGCTAGGACATTGGGG No data
1075154925_1075154937 29 Left 1075154925 10:119967342-119967364 CCAAGGAGTTCTGGGCTGGGGTT No data
Right 1075154937 10:119967394-119967416 AGGACATTGGGGTCATTGATTGG No data
1075154925_1075154934 16 Left 1075154925 10:119967342-119967364 CCAAGGAGTTCTGGGCTGGGGTT No data
Right 1075154934 10:119967381-119967403 AGGGCAAGGGGCTAGGACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075154925 Original CRISPR AACCCCAGCCCAGAACTCCT TGG (reversed) Intergenic
No off target data available for this crispr