ID: 1075154929

View in Genome Browser
Species Human (GRCh38)
Location 10:119967362-119967384
Sequence GTTTTTAAGGAGATTGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075154925_1075154929 -3 Left 1075154925 10:119967342-119967364 CCAAGGAGTTCTGGGCTGGGGTT No data
Right 1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG No data
1075154920_1075154929 5 Left 1075154920 10:119967334-119967356 CCATCTCTCCAAGGAGTTCTGGG No data
Right 1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG No data
1075154916_1075154929 14 Left 1075154916 10:119967325-119967347 CCCTCAAATCCATCTCTCCAAGG No data
Right 1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG No data
1075154918_1075154929 13 Left 1075154918 10:119967326-119967348 CCTCAAATCCATCTCTCCAAGGA No data
Right 1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075154929 Original CRISPR GTTTTTAAGGAGATTGTGGA GGG Intergenic
No off target data available for this crispr