ID: 1075159835

View in Genome Browser
Species Human (GRCh38)
Location 10:120013366-120013388
Sequence CAGGTTAAACTGAAGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075159830_1075159835 2 Left 1075159830 10:120013341-120013363 CCTCACAATGTTGTGTCTACAGG No data
Right 1075159835 10:120013366-120013388 CAGGTTAAACTGAAGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075159835 Original CRISPR CAGGTTAAACTGAAGGAAGG TGG Intergenic
No off target data available for this crispr