ID: 1075161635

View in Genome Browser
Species Human (GRCh38)
Location 10:120029578-120029600
Sequence TCTCTCTGTTGAGGCAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075161635_1075161654 25 Left 1075161635 10:120029578-120029600 CCTGCCCTGCCTCAACAGAGAGA No data
Right 1075161654 10:120029626-120029648 GAGAGGGACAGGGAGGGAGACGG No data
1075161635_1075161645 -1 Left 1075161635 10:120029578-120029600 CCTGCCCTGCCTCAACAGAGAGA No data
Right 1075161645 10:120029600-120029622 ATTGTGGGAGGAGGTGGGAGAGG No data
1075161635_1075161650 14 Left 1075161635 10:120029578-120029600 CCTGCCCTGCCTCAACAGAGAGA No data
Right 1075161650 10:120029615-120029637 GGGAGAGGGAGGAGAGGGACAGG No data
1075161635_1075161651 15 Left 1075161635 10:120029578-120029600 CCTGCCCTGCCTCAACAGAGAGA No data
Right 1075161651 10:120029616-120029638 GGAGAGGGAGGAGAGGGACAGGG No data
1075161635_1075161655 28 Left 1075161635 10:120029578-120029600 CCTGCCCTGCCTCAACAGAGAGA No data
Right 1075161655 10:120029629-120029651 AGGGACAGGGAGGGAGACGGAGG No data
1075161635_1075161652 18 Left 1075161635 10:120029578-120029600 CCTGCCCTGCCTCAACAGAGAGA No data
Right 1075161652 10:120029619-120029641 GAGGGAGGAGAGGGACAGGGAGG No data
1075161635_1075161643 -7 Left 1075161635 10:120029578-120029600 CCTGCCCTGCCTCAACAGAGAGA No data
Right 1075161643 10:120029594-120029616 AGAGAGATTGTGGGAGGAGGTGG No data
1075161635_1075161649 9 Left 1075161635 10:120029578-120029600 CCTGCCCTGCCTCAACAGAGAGA No data
Right 1075161649 10:120029610-120029632 GAGGTGGGAGAGGGAGGAGAGGG No data
1075161635_1075161653 19 Left 1075161635 10:120029578-120029600 CCTGCCCTGCCTCAACAGAGAGA No data
Right 1075161653 10:120029620-120029642 AGGGAGGAGAGGGACAGGGAGGG No data
1075161635_1075161646 0 Left 1075161635 10:120029578-120029600 CCTGCCCTGCCTCAACAGAGAGA No data
Right 1075161646 10:120029601-120029623 TTGTGGGAGGAGGTGGGAGAGGG No data
1075161635_1075161647 3 Left 1075161635 10:120029578-120029600 CCTGCCCTGCCTCAACAGAGAGA No data
Right 1075161647 10:120029604-120029626 TGGGAGGAGGTGGGAGAGGGAGG No data
1075161635_1075161648 8 Left 1075161635 10:120029578-120029600 CCTGCCCTGCCTCAACAGAGAGA No data
Right 1075161648 10:120029609-120029631 GGAGGTGGGAGAGGGAGGAGAGG No data
1075161635_1075161644 -6 Left 1075161635 10:120029578-120029600 CCTGCCCTGCCTCAACAGAGAGA No data
Right 1075161644 10:120029595-120029617 GAGAGATTGTGGGAGGAGGTGGG No data
1075161635_1075161642 -10 Left 1075161635 10:120029578-120029600 CCTGCCCTGCCTCAACAGAGAGA No data
Right 1075161642 10:120029591-120029613 AACAGAGAGATTGTGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075161635 Original CRISPR TCTCTCTGTTGAGGCAGGGC AGG (reversed) Intergenic
No off target data available for this crispr