ID: 1075166121

View in Genome Browser
Species Human (GRCh38)
Location 10:120069795-120069817
Sequence AACCCCATGGGGTTACTATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075166111_1075166121 20 Left 1075166111 10:120069752-120069774 CCATGTGCCTCTTAACTGGTAAA No data
Right 1075166121 10:120069795-120069817 AACCCCATGGGGTTACTATGGGG No data
1075166113_1075166121 13 Left 1075166113 10:120069759-120069781 CCTCTTAACTGGTAAAATAGGAA No data
Right 1075166121 10:120069795-120069817 AACCCCATGGGGTTACTATGGGG No data
1075166110_1075166121 21 Left 1075166110 10:120069751-120069773 CCCATGTGCCTCTTAACTGGTAA No data
Right 1075166121 10:120069795-120069817 AACCCCATGGGGTTACTATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075166121 Original CRISPR AACCCCATGGGGTTACTATG GGG Intergenic
No off target data available for this crispr