ID: 1075166929

View in Genome Browser
Species Human (GRCh38)
Location 10:120077054-120077076
Sequence AACGGCATTTTCAGAGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075166926_1075166929 21 Left 1075166926 10:120077010-120077032 CCGGCTGGAGGCTGGTGGCAGAA No data
Right 1075166929 10:120077054-120077076 AACGGCATTTTCAGAGGAAGTGG No data
1075166925_1075166929 22 Left 1075166925 10:120077009-120077031 CCCGGCTGGAGGCTGGTGGCAGA No data
Right 1075166929 10:120077054-120077076 AACGGCATTTTCAGAGGAAGTGG No data
1075166923_1075166929 27 Left 1075166923 10:120077004-120077026 CCAAGCCCGGCTGGAGGCTGGTG No data
Right 1075166929 10:120077054-120077076 AACGGCATTTTCAGAGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075166929 Original CRISPR AACGGCATTTTCAGAGGAAG TGG Intergenic
No off target data available for this crispr