ID: 1075171475

View in Genome Browser
Species Human (GRCh38)
Location 10:120119758-120119780
Sequence AGGACAAGGTTCTCTTTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075171475_1075171478 -3 Left 1075171475 10:120119758-120119780 CCAAATAAAGAGAACCTTGTCCT No data
Right 1075171478 10:120119778-120119800 CCTCTCTTTTTGTAAATGTAAGG No data
1075171475_1075171479 16 Left 1075171475 10:120119758-120119780 CCAAATAAAGAGAACCTTGTCCT No data
Right 1075171479 10:120119797-120119819 AAGGTTTAGACTTGATATAGAGG No data
1075171475_1075171480 22 Left 1075171475 10:120119758-120119780 CCAAATAAAGAGAACCTTGTCCT No data
Right 1075171480 10:120119803-120119825 TAGACTTGATATAGAGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075171475 Original CRISPR AGGACAAGGTTCTCTTTATT TGG (reversed) Intergenic
No off target data available for this crispr