ID: 1075180383

View in Genome Browser
Species Human (GRCh38)
Location 10:120205793-120205815
Sequence CTCAGCATGCAGAAGTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075180383_1075180388 19 Left 1075180383 10:120205793-120205815 CCTGGACACTTCTGCATGCTGAG No data
Right 1075180388 10:120205835-120205857 GACTTCTTTGATCAGGCCTGAGG No data
1075180383_1075180387 12 Left 1075180383 10:120205793-120205815 CCTGGACACTTCTGCATGCTGAG No data
Right 1075180387 10:120205828-120205850 TCACGCTGACTTCTTTGATCAGG No data
1075180383_1075180389 30 Left 1075180383 10:120205793-120205815 CCTGGACACTTCTGCATGCTGAG No data
Right 1075180389 10:120205846-120205868 TCAGGCCTGAGGCATCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075180383 Original CRISPR CTCAGCATGCAGAAGTGTCC AGG (reversed) Intergenic
No off target data available for this crispr