ID: 1075180387

View in Genome Browser
Species Human (GRCh38)
Location 10:120205828-120205850
Sequence TCACGCTGACTTCTTTGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075180383_1075180387 12 Left 1075180383 10:120205793-120205815 CCTGGACACTTCTGCATGCTGAG No data
Right 1075180387 10:120205828-120205850 TCACGCTGACTTCTTTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075180387 Original CRISPR TCACGCTGACTTCTTTGATC AGG Intergenic
No off target data available for this crispr