ID: 1075180388 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:120205835-120205857 |
| Sequence | GACTTCTTTGATCAGGCCTG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1075180385_1075180388 | -5 | Left | 1075180385 | 10:120205817-120205839 | CCTGTGCCAAGTCACGCTGACTT | No data | ||
| Right | 1075180388 | 10:120205835-120205857 | GACTTCTTTGATCAGGCCTGAGG | No data | ||||
| 1075180383_1075180388 | 19 | Left | 1075180383 | 10:120205793-120205815 | CCTGGACACTTCTGCATGCTGAG | No data | ||
| Right | 1075180388 | 10:120205835-120205857 | GACTTCTTTGATCAGGCCTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1075180388 | Original CRISPR | GACTTCTTTGATCAGGCCTG AGG | Intergenic | ||
| No off target data available for this crispr | |||||