ID: 1075180388

View in Genome Browser
Species Human (GRCh38)
Location 10:120205835-120205857
Sequence GACTTCTTTGATCAGGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075180385_1075180388 -5 Left 1075180385 10:120205817-120205839 CCTGTGCCAAGTCACGCTGACTT No data
Right 1075180388 10:120205835-120205857 GACTTCTTTGATCAGGCCTGAGG No data
1075180383_1075180388 19 Left 1075180383 10:120205793-120205815 CCTGGACACTTCTGCATGCTGAG No data
Right 1075180388 10:120205835-120205857 GACTTCTTTGATCAGGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075180388 Original CRISPR GACTTCTTTGATCAGGCCTG AGG Intergenic
No off target data available for this crispr