ID: 1075180513

View in Genome Browser
Species Human (GRCh38)
Location 10:120206936-120206958
Sequence CAGTGGAGCTGGAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075180513_1075180521 14 Left 1075180513 10:120206936-120206958 CCTCCTTCCCTCCAGCTCCACTG No data
Right 1075180521 10:120206973-120206995 GGCCACCACCACCTTGCATCTGG No data
1075180513_1075180518 -7 Left 1075180513 10:120206936-120206958 CCTCCTTCCCTCCAGCTCCACTG No data
Right 1075180518 10:120206952-120206974 TCCACTGCTACCATCATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075180513 Original CRISPR CAGTGGAGCTGGAGGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr