ID: 1075180518

View in Genome Browser
Species Human (GRCh38)
Location 10:120206952-120206974
Sequence TCCACTGCTACCATCATCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075180511_1075180518 17 Left 1075180511 10:120206912-120206934 CCTCCACAACTGTGTTTCAAATC No data
Right 1075180518 10:120206952-120206974 TCCACTGCTACCATCATCTCAGG No data
1075180512_1075180518 14 Left 1075180512 10:120206915-120206937 CCACAACTGTGTTTCAAATCTCC No data
Right 1075180518 10:120206952-120206974 TCCACTGCTACCATCATCTCAGG No data
1075180513_1075180518 -7 Left 1075180513 10:120206936-120206958 CCTCCTTCCCTCCAGCTCCACTG No data
Right 1075180518 10:120206952-120206974 TCCACTGCTACCATCATCTCAGG No data
1075180514_1075180518 -10 Left 1075180514 10:120206939-120206961 CCTTCCCTCCAGCTCCACTGCTA No data
Right 1075180518 10:120206952-120206974 TCCACTGCTACCATCATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075180518 Original CRISPR TCCACTGCTACCATCATCTC AGG Intergenic
No off target data available for this crispr