ID: 1075180521

View in Genome Browser
Species Human (GRCh38)
Location 10:120206973-120206995
Sequence GGCCACCACCACCTTGCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075180519_1075180521 -3 Left 1075180519 10:120206953-120206975 CCACTGCTACCATCATCTCAGGC No data
Right 1075180521 10:120206973-120206995 GGCCACCACCACCTTGCATCTGG No data
1075180516_1075180521 6 Left 1075180516 10:120206944-120206966 CCTCCAGCTCCACTGCTACCATC No data
Right 1075180521 10:120206973-120206995 GGCCACCACCACCTTGCATCTGG No data
1075180514_1075180521 11 Left 1075180514 10:120206939-120206961 CCTTCCCTCCAGCTCCACTGCTA No data
Right 1075180521 10:120206973-120206995 GGCCACCACCACCTTGCATCTGG No data
1075180517_1075180521 3 Left 1075180517 10:120206947-120206969 CCAGCTCCACTGCTACCATCATC No data
Right 1075180521 10:120206973-120206995 GGCCACCACCACCTTGCATCTGG No data
1075180513_1075180521 14 Left 1075180513 10:120206936-120206958 CCTCCTTCCCTCCAGCTCCACTG No data
Right 1075180521 10:120206973-120206995 GGCCACCACCACCTTGCATCTGG No data
1075180515_1075180521 7 Left 1075180515 10:120206943-120206965 CCCTCCAGCTCCACTGCTACCAT No data
Right 1075180521 10:120206973-120206995 GGCCACCACCACCTTGCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075180521 Original CRISPR GGCCACCACCACCTTGCATC TGG Intergenic
No off target data available for this crispr