ID: 1075183412

View in Genome Browser
Species Human (GRCh38)
Location 10:120232851-120232873
Sequence GCATTGCTTCTTCCTTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075183412_1075183418 26 Left 1075183412 10:120232851-120232873 CCTGACCAAGGAAGAAGCAATGC No data
Right 1075183418 10:120232900-120232922 TGGAAATGTGAATGAATAACTGG No data
1075183412_1075183417 6 Left 1075183412 10:120232851-120232873 CCTGACCAAGGAAGAAGCAATGC No data
Right 1075183417 10:120232880-120232902 CTTGAGAAAATGAGATTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075183412 Original CRISPR GCATTGCTTCTTCCTTGGTC AGG (reversed) Intergenic
No off target data available for this crispr