ID: 1075183418

View in Genome Browser
Species Human (GRCh38)
Location 10:120232900-120232922
Sequence TGGAAATGTGAATGAATAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075183415_1075183418 21 Left 1075183415 10:120232856-120232878 CCAAGGAAGAAGCAATGCGGGTG No data
Right 1075183418 10:120232900-120232922 TGGAAATGTGAATGAATAACTGG No data
1075183412_1075183418 26 Left 1075183412 10:120232851-120232873 CCTGACCAAGGAAGAAGCAATGC No data
Right 1075183418 10:120232900-120232922 TGGAAATGTGAATGAATAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075183418 Original CRISPR TGGAAATGTGAATGAATAAC TGG Intergenic
No off target data available for this crispr